ID: 1142066724

View in Genome Browser
Species Human (GRCh38)
Location 16:88067217-88067239
Sequence GACCAGCCACACAAGCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142066724_1142066730 -7 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066730 16:88067233-88067255 GCTGGTCTCATGGGGCTGAGGGG 0: 1
1: 0
2: 1
3: 25
4: 264
1142066724_1142066735 13 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066735 16:88067253-88067275 GGGGTCAGAGCCGCTGGGCTGGG 0: 1
1: 0
2: 3
3: 50
4: 382
1142066724_1142066733 8 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066733 16:88067248-88067270 CTGAGGGGGTCAGAGCCGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 147
1142066724_1142066734 12 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066734 16:88067252-88067274 GGGGGTCAGAGCCGCTGGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 370
1142066724_1142066737 19 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066737 16:88067259-88067281 AGAGCCGCTGGGCTGGGTGTGGG 0: 1
1: 0
2: 2
3: 35
4: 381
1142066724_1142066738 20 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066738 16:88067260-88067282 GAGCCGCTGGGCTGGGTGTGGGG 0: 1
1: 0
2: 2
3: 54
4: 504
1142066724_1142066728 -9 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066728 16:88067231-88067253 TGGCTGGTCTCATGGGGCTGAGG 0: 1
1: 0
2: 1
3: 35
4: 321
1142066724_1142066732 7 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066732 16:88067247-88067269 GCTGAGGGGGTCAGAGCCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 246
1142066724_1142066729 -8 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066729 16:88067232-88067254 GGCTGGTCTCATGGGGCTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 721
1142066724_1142066736 18 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066736 16:88067258-88067280 CAGAGCCGCTGGGCTGGGTGTGG 0: 1
1: 0
2: 7
3: 70
4: 629
1142066724_1142066731 -6 Left 1142066724 16:88067217-88067239 CCGACTGGCTTGTGTGGCTGGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1142066731 16:88067234-88067256 CTGGTCTCATGGGGCTGAGGGGG 0: 1
1: 0
2: 6
3: 32
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142066724 Original CRISPR GACCAGCCACACAAGCCAGT CGG (reversed) Intronic