ID: 1142067082

View in Genome Browser
Species Human (GRCh38)
Location 16:88068831-88068853
Sequence CTCTTCCTTTCTTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 1, 2: 3, 3: 46, 4: 442}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142067082 Original CRISPR CTCTTCCTTTCTTGGGAAGA AGG Intronic
900688118 1:3962091-3962113 CTCTTCTCTTCTTGGTAACAGGG + Intergenic
901175548 1:7296205-7296227 CACTTACTTTACTGGGAAGATGG - Intronic
902979225 1:20111058-20111080 CTCTGCCTTTCTTGGGTTGTGGG + Intergenic
903816303 1:26066855-26066877 CCCTTCCTTTCTCGGGGAGTTGG + Intronic
904608843 1:31714348-31714370 CTCTTCCTCTCTTTGGAACTCGG + Intergenic
905043475 1:34978442-34978464 CACTTACTCCCTTGGGAAGAGGG - Intergenic
905061888 1:35146965-35146987 CTCTTCCTGTCTTGTGAACTAGG + Intergenic
907114842 1:51959503-51959525 CTCTTCCTTTTTTTGGAATAGGG - Intronic
907647776 1:56261337-56261359 TTCTTTCTTTCTTGGAGAGAAGG - Intergenic
908105088 1:60833201-60833223 CTCTGCCTGACTTGAGAAGAAGG + Intergenic
908797069 1:67840834-67840856 CCTTTCCTTTTTTGGGAAGGAGG - Intergenic
908922527 1:69212622-69212644 CTCTTCCTTTGTTTGCAATAGGG + Intergenic
909609377 1:77536605-77536627 CTCTCTCTTTTTTGGGAAAAAGG - Intronic
909930562 1:81493858-81493880 CTGTTGCTTACTTGGGGAGAGGG + Intronic
910482151 1:87670436-87670458 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
910892062 1:92028842-92028864 ATCTTCCTGTCTTGGGGTGAGGG - Intergenic
911777067 1:101828078-101828100 CTCCTCCTGCCTTGTGAAGAAGG + Intronic
912483545 1:110004810-110004832 CTCTTCCTTTCCTCTGAAAAAGG + Intronic
912873134 1:113328118-113328140 CTCTTCTTTTCTTGGGAAGAAGG + Intergenic
912968479 1:114258204-114258226 CTCTCATTTTTTTGGGAAGAGGG + Intergenic
913127385 1:115805422-115805444 TCCTTCCTGTCTTGAGAAGAGGG + Intergenic
913231031 1:116740953-116740975 CTCTTCCTTTGTTGGGGACTTGG + Intergenic
913559155 1:120000590-120000612 TTCTTCCTTTGTTGTTAAGAAGG - Intronic
914279749 1:146160033-146160055 TTCTTCCTTTGTTGTTAAGAAGG - Intronic
914540787 1:148610951-148610973 TTCTTCCTTTGTTGTTAAGAAGG - Intronic
915560525 1:156684622-156684644 CTCCTTCTTTCTGGGAAAGAAGG + Intergenic
917350804 1:174075758-174075780 TTCCTCCTTCCTTGTGAAGATGG + Intergenic
919388509 1:196952526-196952548 CTCTTCATTTCGTGGGATGATGG + Intronic
919773188 1:201176113-201176135 CTCCTCCTTTCTGGGGAAATTGG - Intergenic
919955520 1:202410978-202411000 CTTTCCTTTTCTTGGGAAGCAGG - Intronic
920420479 1:205829971-205829993 CTCTTCCTCTCTTTGGGAGAGGG - Intronic
920799149 1:209171361-209171383 CTTTTCCTTTCCTCTGAAGAGGG - Intergenic
923961620 1:239090977-239090999 CTCTTGCTGCCTTGTGAAGAAGG + Intergenic
1062761941 10:29170-29192 CTCTTCCTGTCTTAGACAGATGG - Intergenic
1063738850 10:8794938-8794960 CTCTTCCTGCCTTGTGAAGAAGG - Intergenic
1065068894 10:22002708-22002730 CTCTTCCCTTCTGGGAAAGTAGG - Intronic
1065343203 10:24724448-24724470 CTCTTCCTGTGGTGGGAAGGGGG + Intergenic
1065997307 10:31070946-31070968 CTCTTCCTTTCCTGGGTAGAAGG + Intergenic
1066226293 10:33386766-33386788 CACTCCCTTTCTTGGCATGAAGG + Intergenic
1066615653 10:37291058-37291080 TGCTTCCTTTGTTAGGAAGAAGG - Intronic
1066750595 10:38652502-38652524 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1067776738 10:49169904-49169926 CTCTGCCTTTACTGGGCAGAAGG + Intronic
1068737261 10:60428318-60428340 CTCATCCTTCCTTTGAAAGACGG + Intronic
1068954777 10:62813088-62813110 CTCTCCCTTTGTTGGGCAAAGGG - Exonic
1070919000 10:80172302-80172324 CACTTCCTCTCTTGGCAAGGGGG + Intronic
1074559988 10:114526972-114526994 CCCCTCCTTTTTTGGGAACATGG - Intronic
1075164194 10:120052230-120052252 TTCTTCCTTTCTTGGAGAGATGG - Intergenic
1076373003 10:129967016-129967038 CTCGCCCTTTCTGGGGAAGGCGG + Intergenic
1077613654 11:3660217-3660239 CTCTTCCTCTCCAGGGAAGAAGG - Exonic
1077699163 11:4424003-4424025 CTCCTGCTTTCTTGTGAAGAAGG + Intergenic
1078818922 11:14856186-14856208 CTCCTGCTGTCTTGTGAAGAAGG + Intronic
1079099271 11:17530853-17530875 GTCTTCCTCTCTTGGGGAGTAGG + Intronic
1079165511 11:18037938-18037960 CTCTTCCTTTCTTGGGCAACAGG - Intronic
1079166096 11:18044898-18044920 CTCTACCTTTCATGAGAAAAGGG - Intergenic
1080747694 11:35123454-35123476 CTCCTCCTTTTGTGGGGAGAAGG - Intergenic
1081004415 11:37717116-37717138 GTCTTCCTTTTTTGGGGAGATGG - Intergenic
1083255726 11:61494344-61494366 CTCTTCCTGTCCTGGGGACACGG - Intergenic
1083968580 11:66058299-66058321 CTCTTCCTCTGTAAGGAAGAAGG - Exonic
1084473572 11:69376647-69376669 CTCTTCCCTTCCTGGGAAGGGGG + Intergenic
1085725474 11:78951148-78951170 CTCTTCCTTTCTAGGAAGGAAGG - Intronic
1086049899 11:82577548-82577570 CTCCTCCTTACTGGGGAAGCGGG + Intergenic
1086952239 11:92903018-92903040 CTCTTCCTGTCTGGAGAAGCTGG - Intergenic
1087362424 11:97177833-97177855 CTCTTCCTGCCATGTGAAGAAGG - Intergenic
1088838694 11:113603719-113603741 CTCTTCTTTTCTTGGTAGCAGGG + Intergenic
1088961281 11:114668046-114668068 CTCAGCCTTTCTTAGGGAGAAGG + Intergenic
1089001951 11:115059564-115059586 CTCTTACTATGCTGGGAAGATGG - Intergenic
1089319303 11:117614035-117614057 CTTTTCCTTTCCTGGAAAGGTGG + Intronic
1089394378 11:118126354-118126376 TTCTTCCTTCCTTGTGAAAAAGG - Intergenic
1090936666 11:131349013-131349035 CTCTGCCTTTAATGGGATGAGGG + Intergenic
1091145240 11:133273675-133273697 CTCTTCCTTCCGCAGGAAGAAGG + Intronic
1091975736 12:4823326-4823348 CTCTTCCTTCCGCTGGAAGAAGG - Intronic
1093062671 12:14623802-14623824 CTCTTCCTGCCATGCGAAGAAGG + Intronic
1093338734 12:17944159-17944181 CTCTTCTTTTCTATAGAAGAAGG - Intergenic
1093478641 12:19582413-19582435 CTCTTGCTGCCTTGTGAAGAAGG + Intronic
1094208058 12:27861433-27861455 ATTTTCCTGTCTAGGGAAGAGGG + Intergenic
1094229232 12:28083748-28083770 CTCTTTCATTTTTGGGCAGAGGG - Intergenic
1094251837 12:28370803-28370825 CTCCTGCTGTCTTGCGAAGAAGG - Intronic
1094338015 12:29382568-29382590 CTCTTCCTTCTTTGTGAATATGG + Intergenic
1095366098 12:41407272-41407294 CCCTTCCTTTCTTTATAAGAAGG + Intronic
1096837052 12:54357705-54357727 ATCTTCCTTTCCTGTGAGGATGG + Intergenic
1097398344 12:59102657-59102679 CTCTGCTTTTCTGGGGAAGGGGG + Intergenic
1097817419 12:64090164-64090186 CTCTCCCTTTAGTGGAAAGAAGG - Intronic
1098161350 12:67649685-67649707 CTCCGTCTTTCTTTGGAAGAGGG + Intronic
1098237932 12:68436019-68436041 CTCTGCCTTTCTTAGCAAGTTGG + Intergenic
1098442772 12:70535669-70535691 CTTCTCCTTTCCTGGGATGAGGG + Intronic
1098694063 12:73529005-73529027 TTCCTGCTTCCTTGGGAAGAGGG + Intergenic
1099911571 12:88840014-88840036 CTCTTACTGCCTTGTGAAGAAGG - Intergenic
1100584994 12:95971234-95971256 CTCTTCCTTACATGGGAAACTGG + Intergenic
1100721650 12:97365567-97365589 ATCACCCTTGCTTGGGAAGATGG + Intergenic
1100979462 12:100153462-100153484 CTCTTCTTTTCCTGGCAGGAAGG + Intergenic
1101124156 12:101613973-101613995 CTCTTGCTTTCTGGGAAAAAGGG + Intronic
1101747621 12:107555551-107555573 CTCTTTATTTCATGGGAAAACGG + Intronic
1101882927 12:108638342-108638364 CTCTTGCTTTCCTCGGAGGAAGG - Intergenic
1103118423 12:118359106-118359128 AACTTCCTTTCTCGGGATGAAGG - Intronic
1103992990 12:124811753-124811775 TTCTTCCTTTGTCGTGAAGAGGG - Intronic
1104381682 12:128313003-128313025 CTCTTCCTTCCATGAGGAGAGGG - Intronic
1104636540 12:130440986-130441008 CCCTTCCTTTCCTGGGGAGATGG - Intronic
1106438116 13:29741716-29741738 ATCTCCCTCCCTTGGGAAGAGGG + Intergenic
1106457919 13:29943856-29943878 CTCTTCCTGTCTTGGGAAGCCGG - Intergenic
1106572109 13:30936041-30936063 ATCTTACTTTATTGGGAAAAGGG - Intronic
1107575992 13:41723169-41723191 CTCTTTCTTTCTTTGTAAGAAGG + Intronic
1107691163 13:42954946-42954968 TTCTTCATTTCTTTGAAAGATGG - Intronic
1107760144 13:43669487-43669509 CCCTTCCTTTTGTGAGAAGAAGG + Intronic
1107760149 13:43669518-43669540 CCCTTCCTTTTGTGAGAAGAAGG + Intronic
1109185202 13:59259887-59259909 CTCTTCCTTTCTTTGTAATTTGG - Intergenic
1111607660 13:90561785-90561807 TTTTTCCTCTCTTGGGAAGAAGG + Intergenic
1111770701 13:92592260-92592282 CCCTGACTTTCTTGAGAAGAAGG + Intronic
1111770835 13:92593654-92593676 CCCTGACTTTCTTGAGAAGAAGG + Intronic
1113571076 13:111358458-111358480 CTCTTGCTTTGTTGGGAAGGTGG + Intergenic
1114669787 14:24403477-24403499 CTTTTTCTTTCTTGGGTTGATGG + Intronic
1114740660 14:25093884-25093906 CTGTTCCTTTCTGAGGATGAAGG + Intergenic
1114975055 14:28085585-28085607 CCCTCCCTTTCAAGGGAAGAGGG + Intergenic
1115953129 14:38744368-38744390 CTCTTGCCATCTTGTGAAGAAGG - Intergenic
1116563552 14:46415543-46415565 CTCCTCCTTTCTGAGGTAGAAGG - Intergenic
1116830057 14:49710760-49710782 CTGTTCCATTTTTGGGAAGAAGG + Intronic
1118491084 14:66260907-66260929 TTGTTCCTTTCTTGTGCAGACGG + Intergenic
1118888515 14:69887405-69887427 CTCTACCTTTTTGGGGGAGAGGG + Intronic
1119102538 14:71893589-71893611 CCCTTCCCTCCTTGAGAAGAGGG - Intergenic
1119184947 14:72633698-72633720 ACTTTCCTTCCTTGGGAAGATGG - Intronic
1119230677 14:72976964-72976986 CTTTTCCTTTCATGGAAAAAAGG - Intronic
1119253139 14:73174791-73174813 TACTTCCTTCCTTGGGAAGTCGG + Intronic
1119868335 14:77992596-77992618 CTCTTTCTGTTTTGGGGAGAAGG + Intergenic
1119899303 14:78246089-78246111 TTCTTCCTTTCTAGGGACCAGGG + Intronic
1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG + Intergenic
1120359602 14:83481632-83481654 CACTTCCTTTATCAGGAAGACGG + Intergenic
1120836819 14:89046191-89046213 TTCTTCCATTCTTGGCAAGTTGG - Intergenic
1121232792 14:92370340-92370362 CACTTTCTTTGTTGGGAAGATGG + Intronic
1121497416 14:94403548-94403570 CTGTTCTTTTCATGGGATGATGG - Intergenic
1122185125 14:99986391-99986413 CATTTTCTTTCCTGGGAAGAAGG + Intronic
1122309642 14:100786312-100786334 CTCCTCCCTTCTTTGGAAGTGGG - Intergenic
1123510953 15:20999413-20999435 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1123568176 15:21573172-21573194 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1123604283 15:22008494-22008516 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1124268704 15:28260962-28260984 CTCTTCCCTTGTAGGGAAGAAGG - Exonic
1124511830 15:30334302-30334324 CTCTTGCTGCCTTGTGAAGAAGG + Intergenic
1124731084 15:32196455-32196477 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
1124974887 15:34522433-34522455 CTCTTCTTTCCCTGGGAGGAAGG + Intergenic
1126135700 15:45388873-45388895 CTCTTCCTTTCCAGGGGAGTTGG - Intronic
1126604852 15:50466008-50466030 TTCTTTCTTTTTTGGTAAGAAGG + Intronic
1126824827 15:52538676-52538698 CTCCTGCTTCCTTGTGAAGAAGG + Intergenic
1127448044 15:59085772-59085794 CTCTTCCTTTAATGGTAAAATGG + Exonic
1127920279 15:63488964-63488986 CAATTCCTTTTTTGGGAGGAAGG + Intergenic
1128247504 15:66143284-66143306 CTTTCCCTTTCTTGGGAGCATGG - Intronic
1128516254 15:68343902-68343924 CTCTGCCTTTCTGTGGAGGAGGG + Intronic
1129319667 15:74767603-74767625 CTTTTCTTTTCCTGGGAAGAAGG + Intergenic
1129446311 15:75621048-75621070 GTTTTCCTTTGTAGGGAAGATGG - Exonic
1129810423 15:78505890-78505912 CTCTACTTCTCTTGGGATGAGGG - Intergenic
1131720253 15:95160515-95160537 CTTTTCCTGTGTTGGGAATATGG - Intergenic
1132104173 15:99050945-99050967 CTCATCCTCTCTTGAGATGAGGG + Intergenic
1202976533 15_KI270727v1_random:300260-300282 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1133033569 16:3022811-3022833 CTCTTCTGTTGTGGGGAAGAAGG + Exonic
1134280268 16:12810855-12810877 TTCTTCCTTTCTTAGGACAATGG - Intergenic
1135146894 16:19970430-19970452 CTCCTGCTATCTTGTGAAGAAGG + Intergenic
1135517181 16:23145829-23145851 ATTTTCCTTTCTTGGGCTGAAGG + Intronic
1135785716 16:25347337-25347359 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
1136235037 16:28908540-28908562 CTCTGCCCTGCCTGGGAAGAAGG + Intronic
1136404773 16:30038147-30038169 CTCTTCCTTTCTCTGAATGATGG + Intronic
1136732129 16:32424587-32424609 TTCTTATTTTCTTGTGAAGATGG + Intergenic
1137537247 16:49336762-49336784 CCCTTGCTGCCTTGGGAAGAAGG + Intergenic
1137794446 16:51203503-51203525 TTAGTCCTTTCTTGGGAGGAAGG + Intergenic
1137801771 16:51268081-51268103 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
1138640513 16:58382550-58382572 CTCTTGCTGCCTTGTGAAGAAGG + Intronic
1139160142 16:64495123-64495145 AGCTTCCCTTCTTGGGAAGGAGG + Intergenic
1139326516 16:66156525-66156547 CTCTTCCATTCTGGGGGAGGAGG + Intergenic
1140565929 16:76042555-76042577 CTTTTCATTACCTGGGAAGAGGG + Intergenic
1142067082 16:88068831-88068853 CTCTTCCTTTCTTGGGAAGAAGG + Intronic
1202994265 16_KI270728v1_random:92657-92679 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1203020952 16_KI270728v1_random:404999-405021 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1203039287 16_KI270728v1_random:678157-678179 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1142544895 17:693886-693908 CTCTTCTCTTCCAGGGAAGAGGG + Intronic
1142692065 17:1612614-1612636 CTCTGCCTTCCTTGGGCACAAGG + Intronic
1143703595 17:8680755-8680777 CACTTTCTTTCTGGGGAATATGG - Intergenic
1144853095 17:18254009-18254031 CTCTTGCTTCCTTGGGTGGAAGG - Intronic
1146060723 17:29605197-29605219 CTCTTCCTGAGTTGAGAAGATGG - Intronic
1146861522 17:36304391-36304413 CTCTTTTTTTCTTTGGAAAATGG - Intronic
1147091852 17:38108495-38108517 CTCTTTTTTTCTTTGGAAAATGG - Intergenic
1147105359 17:38212005-38212027 CTCTTTTTTTCTTTGGAAAATGG + Intergenic
1147209192 17:38861753-38861775 GTCTTCCTTTTTTTGGTAGAGGG - Intergenic
1147419111 17:40313268-40313290 CCCTTCTTTTGTTGGGGAGATGG - Intronic
1147728735 17:42583368-42583390 CTCTCCTTGTCTTGGGAACAAGG + Intronic
1150532157 17:65995242-65995264 TTCTTCCTTCCTTGGGGACAAGG + Intronic
1150850456 17:68699164-68699186 CTGTTCCTTTGTAGGGGAGAAGG + Intergenic
1151127865 17:71864795-71864817 ATCTTCCTTTCTTAGTAATAAGG - Intergenic
1151419154 17:73985939-73985961 CTCTCCCTTTCTATGGAAGAAGG - Intergenic
1151512437 17:74569496-74569518 ACGTGCCTTTCTTGGGAAGAAGG + Intergenic
1152954849 18:29500-29522 CTCTTCCTGTCTTAGACAGATGG - Intergenic
1155185207 18:23381740-23381762 CTCTTCCATTCTAGAGATGAGGG - Intronic
1155339204 18:24797004-24797026 GTCTTCCTTTCTTGGAAGAAAGG - Intergenic
1155715260 18:28934352-28934374 CTCTTCTTTTGTTGATAAGAAGG + Intergenic
1156307360 18:35889979-35890001 CCCTTCCTTCCTTTGGAAGAAGG - Intergenic
1156706177 18:39885257-39885279 ATCTTCCATTCTGGGGGAGATGG + Intergenic
1157704083 18:49787434-49787456 TTCTTCCTTACTTGGAAAGAAGG - Intronic
1157824433 18:50800184-50800206 CTTTTCCTTGCTTGGGATTATGG - Intronic
1157996424 18:52562527-52562549 CTCTTCATTTCTTGGAAACTTGG - Intronic
1158190788 18:54826437-54826459 CATTTCCTTCCCTGGGAAGAGGG - Intronic
1158724847 18:59961519-59961541 CTCTTCCTTCCTTAGGAATGTGG - Intergenic
1159061072 18:63514428-63514450 CCCTTCCTTTACAGGGAAGAGGG - Intergenic
1159456898 18:68670419-68670441 CTCTTACCGCCTTGGGAAGAAGG - Intergenic
1159735016 18:72085569-72085591 TTCTTCAGTTCATGGGAAGAAGG - Intergenic
1162338425 19:10076214-10076236 CTCTTCTTTTCTTGGATACAGGG - Intergenic
1162613560 19:11776412-11776434 CTGTTGCTTTCTTGGTTAGAAGG + Intronic
1163737920 19:18992804-18992826 CTCATCCTTCCTTGTGAAGCAGG - Exonic
1163915623 19:20238251-20238273 CTCTTCCTGTCTCGGGATGTCGG + Intergenic
1164867715 19:31618718-31618740 CTCTTGCATCTTTGGGAAGAAGG - Intergenic
1165291398 19:34888950-34888972 CTCTTCCTTTCTCTGGCAGCAGG - Intergenic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
1168270125 19:55245378-55245400 CGTGTCCTTTCTTCGGAAGAAGG - Exonic
1168631730 19:57962034-57962056 CTCTTTCTCTCTTTGGAACAGGG + Intronic
925229772 2:2222716-2222738 CTCTTGCCTTCTTGAGGAGAAGG + Intronic
925342513 2:3147243-3147265 ATCGTCCTCTCTGGGGAAGACGG + Intergenic
925587123 2:5475275-5475297 CACCTCCTTTCTTGAGAATAAGG + Intergenic
925906007 2:8539922-8539944 CCCTTCCTTTCTAGGAAACAAGG + Intergenic
926287412 2:11500700-11500722 CTGTTACTTACTAGGGAAGATGG + Intergenic
926484434 2:13437563-13437585 CTCTTGCTGTCTTGTGAAGAAGG - Intergenic
927274337 2:21249287-21249309 GTCTTGCTTCTTTGGGAAGAAGG - Intergenic
927523742 2:23719222-23719244 CTGTTACAGTCTTGGGAAGAAGG - Intergenic
927584983 2:24294621-24294643 CTCTTCCTTACTTGTGCAGTAGG - Intronic
927880994 2:26690076-26690098 CTCTCCTTCTCTTGGGGAGAAGG - Intergenic
928044146 2:27910581-27910603 GTTATCCTTTCATGGGAAGAGGG - Intronic
928444638 2:31322220-31322242 CTCTTCCCTCCTGGGGAGGATGG - Intergenic
928691741 2:33806671-33806693 ACCTTCCTTTTTTGGGAAGGTGG + Intergenic
931988180 2:67761264-67761286 GTTTTCCTTTCTTTGGAAAACGG - Intergenic
932146120 2:69318886-69318908 ATCTCCTCTTCTTGGGAAGAGGG + Intergenic
933053993 2:77638346-77638368 CTCTTCCACTCTTGGGAGAAGGG - Intergenic
933210848 2:79567282-79567304 CTCTTCTTTTCTTCAAAAGATGG + Intronic
933228170 2:79774822-79774844 CTATTCCTTTCCTGGTAAGTGGG - Intronic
934131050 2:88949172-88949194 TATTTCCTTTCTAGGGAAGAGGG + Intergenic
934311456 2:91869872-91869894 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
934313596 2:91894657-91894679 TTCTTATTTTCTTGTGAAGATGG - Intergenic
934719534 2:96564023-96564045 CTTTGCCCTTTTTGGGAAGAAGG + Intergenic
935737135 2:106115225-106115247 TTCTTCCCTTCTTAGGAAGGTGG - Intronic
936411448 2:112261725-112261747 TTTATCCTTTCTTGGGAAAATGG + Intergenic
937100524 2:119264727-119264749 CTCTTCCTTCCATCAGAAGATGG - Exonic
937464084 2:122114641-122114663 CTCTTCCTTTGTTGTGAGGATGG + Intergenic
939027994 2:137036948-137036970 CTCTTCCTTCTCTGAGAAGAAGG + Intronic
939827807 2:147036216-147036238 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
940197884 2:151115886-151115908 TTCTTCCTTTATGAGGAAGAAGG - Intergenic
941067181 2:160916510-160916532 GGCTTCCCTTCTTGTGAAGATGG - Intergenic
942250937 2:174047303-174047325 TTCTTCCTCTTCTGGGAAGAAGG - Intergenic
942415415 2:175753663-175753685 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
942449105 2:176098298-176098320 CTCGTCCTCTCTTGGGAGGTGGG - Intergenic
943656573 2:190515034-190515056 CTTTTCCTTTCATGACAAGAAGG - Intronic
943792437 2:191948648-191948670 CTCTTCCTTTATGGGGAGGAAGG + Intergenic
944046161 2:195414183-195414205 CTCTGCTTTTCTTGGGCACAAGG - Intergenic
944193986 2:197032919-197032941 CTCTTTGTTTCTTATGAAGAAGG - Intronic
944850896 2:203717863-203717885 ATCTTCATTTCTTGTGAAAATGG + Intronic
945109721 2:206350644-206350666 CTCTTGCTGTCTTGTGAAGAGGG - Intergenic
945220167 2:207475466-207475488 CTCTTCCATTCTAAGGAAAAGGG + Intergenic
946117531 2:217476445-217476467 CTCTTCCTTGTTTAGGAAGTTGG - Intronic
946581108 2:221128957-221128979 CTCTTGCTTCCTTGTGAAGAAGG + Intergenic
947936677 2:234010944-234010966 TGCTTCCTTTGTTGTGAAGAAGG + Intronic
948024902 2:234769116-234769138 CTCTTCCTCCCCTGAGAAGAAGG + Intergenic
948530236 2:238599528-238599550 CTCTTCCTTTCCTGGTCTGAGGG - Intergenic
948667534 2:239545856-239545878 CTCTTCCTTTCCTGAGAGCATGG + Intergenic
948954398 2:241275568-241275590 CTCTGTCTTTTTTGGGATGAGGG - Intronic
948984369 2:241511173-241511195 CACTTTCTTCCTTGGGAATATGG + Intergenic
1170548382 20:17454556-17454578 ATCTTCCTTTCTTGGCAACTAGG + Intronic
1170717085 20:18841022-18841044 CTCTTCCTCTCTTGGGGTTAAGG - Intergenic
1172336367 20:34119725-34119747 CCCATCCTCTCTTGGGAAGGAGG - Intergenic
1172745737 20:37207222-37207244 CTCTTCCTCTGCTGGGAAGGTGG - Intronic
1173336692 20:42117809-42117831 CTTTTCCTTTCTTTTTAAGATGG + Intronic
1173737699 20:45373501-45373523 TTTTCCCTTTCTTGGGAAAATGG + Exonic
1174113027 20:48209203-48209225 CTCTTCCTTCCTTGGGGAAGTGG + Intergenic
1174771269 20:53302672-53302694 TTCCTCCTTTCTTGAGAATAAGG - Intronic
1174878760 20:54253933-54253955 CTCTTCCCCTCGTGTGAAGAGGG - Intergenic
1175010889 20:55734576-55734598 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
1176258768 20:64167913-64167935 CTCTTCCCTTCTGGGAAACACGG - Intronic
1177147113 21:17418662-17418684 CTCTTCCTATCACGGGAAGAAGG - Intergenic
1177356528 21:20015194-20015216 CTTTTGCTTCCTTGTGAAGAAGG + Intergenic
1178125263 21:29508989-29509011 GGCTTCTTTTGTTGGGAAGATGG + Intronic
1178355801 21:31909829-31909851 CACATCGTTTCTTTGGAAGATGG + Intronic
1179136927 21:38687845-38687867 CTCTTCCTTTGTTCTGCAGATGG - Intergenic
1179613755 21:42568733-42568755 TTCTGCCTTTCTTGAGATGAAGG - Intronic
1180538209 22:16415671-16415693 CTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1182580686 22:31308667-31308689 CTCTTCCTTTCTAAAGACGAGGG - Intergenic
1183733675 22:39631875-39631897 CCCTTCCTTGCCAGGGAAGAGGG - Intronic
1184510102 22:44928399-44928421 AAGTTCCTTTCATGGGAAGAAGG - Intronic
1184659876 22:45960809-45960831 CTCTTCCTTAGGTGGGCAGAGGG + Intronic
949187185 3:1206276-1206298 CTCTTATTTCCTTGGGAAGTAGG - Intronic
949258612 3:2080078-2080100 ATGTTCTTTGCTTGGGAAGATGG + Intergenic
949317258 3:2770457-2770479 CACTTCCTCTCTTGGGATGAAGG - Intronic
949411051 3:3764794-3764816 CTTTTGCTTTATTGGGAAGCAGG + Intronic
950852128 3:16072135-16072157 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
950950811 3:16996344-16996366 CTCTTCCTTCCTGGGTAGGAAGG - Intronic
951142601 3:19182524-19182546 CTCTTCTTTTCTTGGGGGGACGG - Intronic
951400500 3:22227332-22227354 CACGTCCTTCCTTGGGCAGATGG - Intronic
951421785 3:22494941-22494963 CTATTCCTTTCCTGGAAAGATGG + Intergenic
951920996 3:27853870-27853892 CTCCTCCTTCCATGTGAAGAAGG - Intergenic
952044026 3:29296006-29296028 CTCTTCCTTTGGTAAGAAGATGG + Intronic
952597931 3:35042033-35042055 ATATTCCTTTCTTAGGAAGTAGG + Intergenic
952840381 3:37640925-37640947 CTGTTCCCTTCCTGGGAAGCCGG + Intronic
953254405 3:41275785-41275807 CTGTACATTTCTTGGGGAGATGG - Intronic
953494869 3:43377416-43377438 CTCCTCCTTGCCTGGGAGGAAGG + Intronic
953504979 3:43476683-43476705 CTCAAGATTTCTTGGGAAGATGG - Intronic
953591196 3:44256458-44256480 ATCTTCCTTGCCTGGGAAAATGG + Intronic
953797241 3:45995233-45995255 TTCTTCCCCTCCTGGGAAGAGGG + Intronic
953844716 3:46418276-46418298 CTCATCCATTAATGGGAAGAGGG + Intergenic
955008332 3:54990587-54990609 CTCTGTCTTTCTGGAGAAGATGG - Intronic
956089055 3:65644550-65644572 CTCTTCTTTTCTTTGAAACAGGG - Intronic
956563885 3:70614385-70614407 CTCATTCATTATTGGGAAGATGG + Intergenic
957460947 3:80519848-80519870 CTTCTCCTTACTTGGGAAAAAGG + Intergenic
959578132 3:107957100-107957122 CGCTTCCCTTCTAGGGAAGAAGG + Intergenic
960243246 3:115370607-115370629 CTCCTGCTGTCTTGTGAAGAAGG + Intergenic
960989029 3:123298622-123298644 ATGTTCCTCTCTTGGGAAGGTGG - Intronic
961947450 3:130707310-130707332 CACTTCATTTCTAGGGCAGATGG + Intronic
962563043 3:136628199-136628221 CTCCTGCTGTCTTGTGAAGAAGG + Intronic
962629153 3:137258461-137258483 TTCTTCCTTTCTGGGAAAGGGGG + Intergenic
962900132 3:139754606-139754628 CTCACCCCTTCTTGGGGAGAGGG + Intergenic
963394287 3:144712659-144712681 TGTTTCCTTTCTTGGGCAGAAGG + Intergenic
963433849 3:145242893-145242915 CTCCTCCTGTCATGTGAAGAAGG - Intergenic
963814345 3:149813014-149813036 CTCTTCCCTTCCAGGGAAGACGG + Exonic
964167811 3:153729910-153729932 CTCTTTCTTTATTGGAAATAGGG + Intergenic
965809627 3:172578422-172578444 CTCCTGCTTCCTTGTGAAGAAGG + Intergenic
966129697 3:176623555-176623577 CTCTTCTTTTCATGGGAGTATGG - Intergenic
966386803 3:179407894-179407916 CTCGTAATTTCTTGAGAAGAGGG + Intronic
966394841 3:179492144-179492166 CTCTTCCCTTTGTGGGAAAAAGG + Intergenic
968358875 3:198132642-198132664 CTCTTCCTGTCTTAGACAGATGG + Intergenic
968759280 4:2433684-2433706 CTGTCCCTTTCTTGGCTAGATGG - Intronic
968765061 4:2463821-2463843 TTCTCTCTTTCCTGGGAAGAAGG - Intronic
969149388 4:5155718-5155740 CTCCTCCTGCCTTGTGAAGAAGG + Intronic
969296109 4:6271331-6271353 CTCTTCCATCCTGGGAAAGAAGG - Intronic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
970378292 4:15480631-15480653 CTGTTCCTCTCTTGGGAAGATGG - Intronic
970664707 4:18323349-18323371 TTCTTCCTCTCTTGGGCATAGGG - Intergenic
971091546 4:23351733-23351755 CTTGTCCTTTCTTGGGAATGGGG - Intergenic
971485991 4:27160793-27160815 CTCTTCCTTTCATGGAATTACGG + Intergenic
971886072 4:32449842-32449864 ATCTTATTTTCCTGGGAAGATGG + Intergenic
972281954 4:37610838-37610860 CTCCTCCTTTCTAAGGATGAGGG - Intronic
974055034 4:56976398-56976420 CTCTTCGTTTCCTGGCAAGGTGG - Intronic
974832530 4:67206972-67206994 CTCCTGCCTTCTTGTGAAGAAGG - Intergenic
974924342 4:68278657-68278679 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
976199466 4:82563938-82563960 CACTCCCTTTCTTGGGAATAGGG + Intergenic
976590482 4:86844851-86844873 CTCTTGCTGCCTTGTGAAGAAGG - Intronic
976864617 4:89709054-89709076 TCCTTCCTTTCTTTGGGAGAAGG - Intergenic
979224663 4:118271066-118271088 CTTTTTCTTTCTTTCGAAGATGG - Intergenic
979906652 4:126301539-126301561 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
980646690 4:135652081-135652103 CTCTCCTTTTCTCAGGAAGAAGG - Intergenic
980846003 4:138325778-138325800 CTTTTCCTTTCTTGGGTGAAAGG - Intergenic
982455550 4:155605243-155605265 CAATTCCTGTCTTGGGAACATGG - Intergenic
983049062 4:163022758-163022780 CTCTTCCTTTTTTCAGATGATGG - Intergenic
983138706 4:164121440-164121462 CTCTTGCTGCCTTGTGAAGAAGG - Intronic
983472679 4:168176057-168176079 CTCCTCCTTTCTTTCCAAGAAGG + Intronic
983641571 4:169948241-169948263 CTCCTACTTTATGGGGAAGATGG - Intergenic
986289856 5:6391039-6391061 CTCCTGCTGTCTTGTGAAGAAGG + Intergenic
986763978 5:10906580-10906602 GTTTTCCTTTCTTAGTAAGAAGG + Intergenic
987013309 5:13790659-13790681 TTCTTGCTATCTTGTGAAGAAGG + Intronic
987416947 5:17671561-17671583 CTCCTGCTGTCTTGTGAAGAAGG + Intergenic
987496577 5:18652862-18652884 CTCTGCTTTTCTTATGAAGAAGG + Intergenic
987546021 5:19310973-19310995 CTCTTGCTGTCCTGTGAAGAAGG - Intergenic
987891341 5:23882066-23882088 CTCTTGCTGCCTTGAGAAGAAGG + Intergenic
987968929 5:24916679-24916701 ATTTTCCTTTCTTGAGAAAATGG - Intergenic
988225907 5:28411315-28411337 GTCTTACTTTCTTGGAAAGCAGG + Intergenic
988685186 5:33518913-33518935 CTCTTCTTTTTTTGGGAGGTGGG - Intergenic
988826809 5:34944556-34944578 TTCTTCCTTTCTGGGGATGGGGG - Intronic
989033997 5:37150550-37150572 CTCTTCCTTAGTTTGGAAAATGG + Intronic
992136527 5:73751654-73751676 CTCCTCCTTCCTTAGGAGGAAGG + Intronic
992414523 5:76539659-76539681 CTTGTCCTTGCATGGGAAGAGGG + Intronic
992547093 5:77823623-77823645 CACTTCCTTACCTGGGAAGTTGG - Intronic
992563729 5:77977154-77977176 CTCTTCCTACCTTGGGTAGAAGG + Intergenic
993118466 5:83745859-83745881 CTCTTCTATTTTTTGGAAGAGGG + Intergenic
993788751 5:92179058-92179080 CTCTTCCTTTCATAGGAGAAGGG - Intergenic
995056437 5:107764606-107764628 CCATCCCTTCCTTGGGAAGAAGG - Intergenic
996621979 5:125516512-125516534 CTGTTACTATCTTGGGAATAAGG + Intergenic
997024088 5:130037337-130037359 CTGTACCTTCCTTGGCAAGAGGG - Intronic
997522716 5:134533531-134533553 CTCTTCATTTCCTGCAAAGAAGG - Intronic
997692075 5:135833811-135833833 CTCTGTCTTGCTTTGGAAGAAGG + Intergenic
998041961 5:138956263-138956285 ATCTTTCTTTCTGGGCAAGAAGG - Intronic
999333975 5:150699419-150699441 CCCAACCTTTTTTGGGAAGAGGG + Intronic
1000246764 5:159454652-159454674 CTGTTCCTTTCTTGGTGACATGG + Intergenic
1000447424 5:161339982-161340004 CTTTTCTCTTCTTTGGAAGATGG - Intronic
1000498842 5:162021845-162021867 CTCTGCTTTTCTTAAGAAGAAGG - Intergenic
1000982053 5:167826524-167826546 CTTTTCCTTTCTTGGCTTGAAGG - Intronic
1001093144 5:168756354-168756376 CTGGTCCCTCCTTGGGAAGAGGG - Intronic
1001634547 5:173200308-173200330 CCCTTCCCTTCTTGGGGTGAAGG + Intergenic
1002978030 6:2105359-2105381 CACTTCTTCTCTAGGGAAGATGG + Intronic
1004266797 6:14155248-14155270 CTCTGTCTTTGATGGGAAGAGGG - Intergenic
1004457913 6:15808639-15808661 CTCTTGCTGCCTTGTGAAGAAGG + Intergenic
1004673628 6:17820808-17820830 CTTTTCCATTCTTGGGATGATGG - Intronic
1004719508 6:18255026-18255048 CACTTCCTTTCCTGTCAAGATGG + Intronic
1004814226 6:19295076-19295098 CTCTTCCTAGTTTGGTAAGAAGG - Intergenic
1005218156 6:23555603-23555625 CTCTTGCTCTCATGTGAAGAAGG - Intergenic
1005270678 6:24159993-24160015 CTCTGCCTTGCATGGGAATAAGG - Intergenic
1005409864 6:25533003-25533025 TTCTTTCTTTCTTGGTGAGAAGG - Intronic
1006014018 6:31066554-31066576 CACCTCCTTTCATGGGTAGAAGG - Intergenic
1007258648 6:40546346-40546368 CTCATTCTTCCTTGGGAAGAAGG + Intronic
1007532307 6:42553989-42554011 CTCTGCTTTTCTTGGGGACAAGG - Intergenic
1007542206 6:42657457-42657479 CTCTTCCCCTCTTAGGAAAAAGG + Intronic
1007614839 6:43173780-43173802 CTCTACCTTCCTTGAGAAGTTGG - Intronic
1007660085 6:43478705-43478727 CTTTTGCTTTTTTGGTAAGAAGG + Intronic
1008170979 6:48204993-48205015 CACTTACTTTTTTGAGAAGAAGG + Intergenic
1008349008 6:50466002-50466024 CTTTGCATTTCTTGGGAGGAAGG - Intergenic
1008399041 6:51042553-51042575 TTCTTCCTTTCTTGGGATCAGGG - Intergenic
1009370340 6:62893122-62893144 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
1009446861 6:63753054-63753076 CTTTTCTTTTCTTGGTAAGAGGG + Intronic
1010500208 6:76590194-76590216 CCCTTCCTTTCTTGTGGAGAAGG + Intergenic
1011621651 6:89249264-89249286 CTCTTCCCCTTTTGGGAACATGG + Intergenic
1011909297 6:92415707-92415729 CTTAACCTTTCTTGGGAGGATGG + Intergenic
1012653061 6:101781966-101781988 CTCTTTCTGTCATAGGAAGATGG - Intronic
1013620266 6:111880832-111880854 CTCCTGCCTTCTTGTGAAGAAGG + Intergenic
1014397288 6:120940804-120940826 CTTTTCCTTTCTTTTGAAGAGGG + Intergenic
1015796041 6:137012361-137012383 CTCTTTCTGTCTGGGGCAGATGG + Intronic
1016256497 6:142111809-142111831 CTGTTTCTTTCTTGGTAAGATGG + Intergenic
1018570353 6:165203658-165203680 CTCCTGCTGCCTTGGGAAGAGGG - Intergenic
1018895560 6:168013921-168013943 TTGGTCCTTTCTTGGGCAGAGGG + Intronic
1019157436 6:170048737-170048759 CTCTTCCTCTTTTTGGAAGGAGG - Intergenic
1019860848 7:3657075-3657097 CTCCTCCTTTGTGGGGGAGAAGG - Intronic
1020132209 7:5565139-5565161 CTCTTTCTTTCTTTCTAAGATGG - Intergenic
1020516034 7:9120559-9120581 CTCTGGCTTTCTTGGGAACTTGG + Intergenic
1020530329 7:9325163-9325185 ATTTCCCTTTATTGGGAAGAAGG + Intergenic
1021055688 7:16043376-16043398 TTGTTCCTTTTTGGGGAAGAGGG + Intergenic
1022586537 7:31618530-31618552 CTCTACCTTTTCTGAGAAGAAGG - Intronic
1023716250 7:43047062-43047084 CTCTTCTTTTCTCTAGAAGAAGG - Intergenic
1024150411 7:46566403-46566425 CCCCTCCTTTCTTAAGAAGATGG + Intergenic
1024473165 7:49784012-49784034 TCCTTCCTTTCCTGGGAATATGG + Intronic
1024486755 7:49928159-49928181 CTCTTCCTTCCTTGCCAATAGGG - Intronic
1024589395 7:50868011-50868033 CTCTTGCCTTCTTGGGCAGCAGG + Intergenic
1024661276 7:51497496-51497518 CTCTGCTTTTCTTGAGTAGAAGG + Intergenic
1025191782 7:56901221-56901243 CTCTTTCTTTTTTTGGAAGCAGG + Intergenic
1025680168 7:63675713-63675735 CTCTTTCTTTTTTTGGAAGCAGG - Intergenic
1026005692 7:66598675-66598697 TTCTTCCTTTCTGGTGCAGAAGG + Intergenic
1026573033 7:71548421-71548443 CTTTTCTTTTGTTGGGAGGAGGG + Intronic
1026849746 7:73717347-73717369 CTCTTCCTTTCTGGGGATTCTGG + Intronic
1028817109 7:95158489-95158511 TTCTTCCTTTTTTGGGGAGGTGG - Intronic
1029169494 7:98620686-98620708 CTCCTCCTGTCATGGGAGGAGGG - Intronic
1030150335 7:106398311-106398333 ATCTTCCTTTCTTCAGAAGTAGG - Intergenic
1031579844 7:123459455-123459477 GTCTTCCTTACTTGGGGACAGGG - Intronic
1032737566 7:134706524-134706546 ATCATCCTTTCTTGGAAAGGAGG - Intergenic
1033083934 7:138324993-138325015 CACTGCCTTGCTTGGGAAGATGG - Intergenic
1033978794 7:147137978-147138000 CTATTCCTTTATTGAGAAAAAGG - Intronic
1034854767 7:154532915-154532937 CTCTGACTTTCTTCTGAAGAAGG + Intronic
1035029331 7:155847250-155847272 CGCATCTTTACTTGGGAAGAAGG + Intergenic
1035891507 8:3348740-3348762 CTCTTCCTTCATTGGGAAAGAGG - Intronic
1036724125 8:11203970-11203992 CTTCTACTTTCTTTGGAAGAAGG + Intergenic
1037707536 8:21327823-21327845 CACTTCCTATCTTGTTAAGAAGG - Intergenic
1037917582 8:22781829-22781851 CCCTTCCTCCCTGGGGAAGAGGG + Intronic
1038055711 8:23855803-23855825 CAGTTCATTTCTTGGGGAGAGGG + Intergenic
1038601285 8:28945780-28945802 CTCTGCCTTTCATGGGGAAAAGG + Intronic
1038650560 8:29399284-29399306 CTCTTTGTGTCTGGGGAAGATGG + Intergenic
1039191742 8:34983931-34983953 TGCTTCCTTTCTTTGTAAGATGG - Intergenic
1039296123 8:36157135-36157157 CTCTGCCTCTCTGGGGAAGGAGG + Intergenic
1039668660 8:39568327-39568349 CTCCTGCTGTCTTGAGAAGAAGG - Intergenic
1039908369 8:41803789-41803811 CTTTTCCTTTTTTGTGAAGGTGG + Intronic
1041056645 8:53992772-53992794 TTCTTCTGTTCTTGGGAAGCTGG - Intronic
1043106297 8:76115988-76116010 CTTATCCTTTCTTGGGAGCAGGG - Intergenic
1043213878 8:77560565-77560587 CTTTTTCTTTATTGGTAAGATGG - Intergenic
1043292498 8:78620459-78620481 CTCATTCTTTGTTGGTAAGAAGG - Intergenic
1043390836 8:79790274-79790296 CTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1045253888 8:100503217-100503239 CTGTCCCTTTGTTGGGAGGATGG - Intergenic
1046311370 8:112441683-112441705 TTCTTACTATCTTGTGAAGAAGG - Intronic
1047225251 8:122951100-122951122 CTCTTCCTTTTTTTGGAAGGAGG - Intronic
1047617686 8:126576504-126576526 CTCATTCTGTCTTGTGAAGAAGG - Intergenic
1047780708 8:128108727-128108749 CTTTTCTTTATTTGGGAAGATGG + Intergenic
1049882335 8:145074728-145074750 CTCTTCCTGTCTTAGACAGATGG + Intergenic
1050075375 9:1857435-1857457 CTGTTCCTTTCTTGTGTAGGAGG - Intergenic
1050112183 9:2228377-2228399 CACTTCCTTTGTTTTGAAGAAGG - Intergenic
1050807373 9:9698216-9698238 CTAGTCCTTTGATGGGAAGACGG - Intronic
1052788396 9:32851289-32851311 CTCTTGCTGCCTTGTGAAGAAGG - Intergenic
1052991280 9:34520646-34520668 CCCTTCTTTTCCTGGGGAGAGGG - Exonic
1053428393 9:38026049-38026071 CTGATCCTTCCTTGGGAAGGGGG - Intronic
1056237970 9:84614878-84614900 CTCTTCCTTGCCAGGGCAGATGG - Intergenic
1056444635 9:86653906-86653928 CTCCTGCTGTCTTGTGAAGAAGG - Intergenic
1056821294 9:89843936-89843958 CTCTTCCTTTCTGGGTGGGATGG + Intergenic
1057757727 9:97851591-97851613 TTCTCCATTACTTGGGAAGAAGG + Intergenic
1059001047 9:110349300-110349322 GTCTTTTTTTCTTGGGGAGAGGG - Intergenic
1059084459 9:111285007-111285029 CTATTGTTTTCTTGTGAAGATGG - Intergenic
1059444030 9:114327246-114327268 CTCCTGCTGTCTTGTGAAGAAGG + Intergenic
1059445237 9:114334025-114334047 CTCCTGCTGTCTTGTGAAGAAGG + Intergenic
1059845240 9:118268285-118268307 CTCCTCTTTTCTGGGGAGGAGGG + Intergenic
1060421131 9:123470430-123470452 CGCTTCCTTTCTTGGGACTTTGG - Intronic
1062743004 9:138191773-138191795 CTCTTCCTGTCTTAGACAGATGG + Intergenic
1062743253 9:138193773-138193795 CTCTTCCTGTCTTAGACAGATGG + Intergenic
1062743502 9:138195774-138195796 CTCTTCCTGTCTTAGACAGATGG + Intergenic
1185602963 X:1352679-1352701 CTCTTCCTGGCTTGGAGAGAGGG + Intronic
1185912554 X:3998657-3998679 CTGTTCATGTCTTGGGATGAGGG + Intergenic
1186603535 X:11064686-11064708 TTCTCCCTTTGTTGGGAAGTTGG - Intergenic
1186670615 X:11764187-11764209 CTCTCCCATTTTGGGGAAGACGG + Intronic
1186951725 X:14633743-14633765 CTCCTGCTTCCTTGTGAAGAAGG - Intronic
1187753891 X:22498549-22498571 TCCTTCATTTCTTGGGAAGTTGG - Intergenic
1188172054 X:26939535-26939557 CTCCTCCTTTCCTGAGCAGATGG + Intergenic
1189569172 X:42276822-42276844 TTCTTTTTTTCATGGGAAGATGG + Intergenic
1190280057 X:48923514-48923536 CCCTTCTTTTCTTGGGGAGATGG + Intronic
1190375251 X:49782843-49782865 CTCCTGCTACCTTGGGAAGAAGG + Intergenic
1192402803 X:70853897-70853919 CTGTTCCTTTCTGGAGAGGAGGG - Intronic
1194958113 X:100204839-100204861 CTGTTCCTTTCTTTGGAAATAGG + Intergenic
1195566191 X:106341714-106341736 CTCTTTCTTTCTTTTGAAAAGGG - Intergenic
1195822237 X:108957499-108957521 CTCTTCCCACCTTGTGAAGAAGG + Intergenic
1197169505 X:123415510-123415532 CTCTTTCTTTACTGAGAAGATGG - Intronic
1197569647 X:128132670-128132692 CTCTTGCTGCCTTGTGAAGAAGG + Intergenic
1197985889 X:132266111-132266133 CTGTTCCTTTCTTGGCACCAGGG + Intergenic
1199830107 X:151540646-151540668 GACTTCCATTTTTGGGAAGATGG - Intergenic
1201181509 Y:11352148-11352170 TTCTTATTTTCTTGTGAAGATGG - Intergenic
1202579077 Y:26360196-26360218 CTTTCCTTTTCTTGGGAAGCAGG + Intergenic