ID: 1142070258

View in Genome Browser
Species Human (GRCh38)
Location 16:88087923-88087945
Sequence AAGGGCTGACGAAATGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142070257_1142070258 -6 Left 1142070257 16:88087906-88087928 CCGTGTTGTGGACGAACAAGGGC 0: 2
1: 0
2: 0
3: 2
4: 45
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070253_1142070258 3 Left 1142070253 16:88087897-88087919 CCTGCCTAGCCGTGTTGTGGACG 0: 2
1: 0
2: 0
3: 2
4: 49
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070250_1142070258 14 Left 1142070250 16:88087886-88087908 CCCTGAGCACACCTGCCTAGCCG 0: 2
1: 0
2: 0
3: 11
4: 93
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070254_1142070258 -1 Left 1142070254 16:88087901-88087923 CCTAGCCGTGTTGTGGACGAACA 0: 2
1: 0
2: 0
3: 0
4: 28
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070247_1142070258 23 Left 1142070247 16:88087877-88087899 CCTCAGACCCCCTGAGCACACCT 0: 2
1: 0
2: 2
3: 32
4: 308
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070251_1142070258 13 Left 1142070251 16:88087887-88087909 CCTGAGCACACCTGCCTAGCCGT No data
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070248_1142070258 16 Left 1142070248 16:88087884-88087906 CCCCCTGAGCACACCTGCCTAGC No data
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112
1142070249_1142070258 15 Left 1142070249 16:88087885-88087907 CCCCTGAGCACACCTGCCTAGCC 0: 2
1: 0
2: 1
3: 15
4: 196
Right 1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG 0: 1
1: 1
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142070258 Original CRISPR AAGGGCTGACGAAATGCCTG TGG Intronic
903838383 1:26220696-26220718 GAGGGGAGAGGAAATGCCTGTGG + Intergenic
904236464 1:29120645-29120667 AGAGGCTGAAGAAATTCCTGAGG + Exonic
908044499 1:60154039-60154061 AAGGGCTGTCTAAATGCATGGGG + Intergenic
909321703 1:74296983-74297005 AAGAAATGAAGAAATGCCTGAGG - Intronic
912304758 1:108556200-108556222 AAGGTGTGATGACATGCCTGTGG + Intergenic
915106918 1:153540579-153540601 AAAGGCTGGTGAACTGCCTGTGG - Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
920422536 1:205844881-205844903 AAGGCCTGCAGTAATGCCTGGGG + Exonic
923266287 1:232317686-232317708 AAAGGCTGGCAAAATTCCTGGGG - Intergenic
923757285 1:236803428-236803450 AAGGTCTGAAGAAAACCCTGCGG + Exonic
1065137938 10:22691083-22691105 AAAGTCTTAAGAAATGCCTGAGG + Intronic
1066310937 10:34195970-34195992 AAGGGCTTATGCAGTGCCTGGGG + Intronic
1066415867 10:35221146-35221168 AAGGGCAGAGGAAACTCCTGCGG - Intergenic
1076997927 11:308043-308065 AAGGGCAGAACAAATTCCTGAGG - Exonic
1077578392 11:3401707-3401729 GAGGGCTGAAGAAAGGCCTCAGG - Intergenic
1080414476 11:32056387-32056409 ACGGGCAGACGAGGTGCCTGGGG + Intronic
1081140546 11:39493690-39493712 AAGGTCTGACTGACTGCCTGTGG + Intergenic
1084235428 11:67785221-67785243 GAGGGCTGAAGAAAGGCCTCAGG - Intergenic
1085080480 11:73629816-73629838 AAGGGTTCAATAAATGCCTGTGG + Intergenic
1089394975 11:118130797-118130819 AAGGGCTGGCCATCTGCCTGAGG + Intergenic
1090800249 11:130166464-130166486 AAGGGGTGACGAGCAGCCTGAGG - Intronic
1091156519 11:133379393-133379415 AAGTGCTGAAGAAATGGGTGTGG - Intronic
1100273716 12:93050522-93050544 AAGGGCTGATGAAAGGACTATGG - Intergenic
1102973308 12:117188815-117188837 AAGGGTTGACGAAATTAATGTGG - Intronic
1105045628 12:133001170-133001192 AAGGGCTGACAGGAAGCCTGAGG - Intronic
1107158537 13:37198181-37198203 AATGCCTGAAGATATGCCTGGGG + Intergenic
1107232218 13:38123819-38123841 AAAGGCAGAAGAATTGCCTGAGG - Intergenic
1112146329 13:96704594-96704616 ATGGGCTGAAGAGAAGCCTGAGG + Intronic
1112195503 13:97222244-97222266 TAGGGCTGACGAGCTGGCTGGGG + Intronic
1113594557 13:111521769-111521791 GAGGCCTTCCGAAATGCCTGTGG + Intergenic
1117375754 14:55117017-55117039 CAGGGCTGCCGAAATGACAGTGG - Intergenic
1119780877 14:77276157-77276179 AAGGGATGAAGAAAACCCTGTGG - Exonic
1122062884 14:99148448-99148470 AAGGGCTGGTGAAATGCCCCAGG - Intergenic
1127299840 15:57642471-57642493 AAAGGCTGCCTATATGCCTGGGG - Intronic
1127466045 15:59245802-59245824 AAGGGCTTCAGAAATGCCTCTGG + Intronic
1128426428 15:67546067-67546089 AAGGCCTGACGAAGGACCTGTGG + Intronic
1132242353 15:100267646-100267668 AAGGGCTGAGGAACTACCTCTGG - Intronic
1133346993 16:5077855-5077877 GAGGGCTGAAGAAAGGCCTCAGG - Intronic
1135850984 16:25963612-25963634 AAATGCTGATGAAATGCCTTTGG - Intronic
1136266968 16:29127600-29127622 AAGGGCTGATGAAATGCCTGTGG + Intergenic
1141198464 16:81879135-81879157 GAGGGCTGAAGAATTGCATGTGG + Intronic
1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG + Intronic
1142104413 16:88294758-88294780 AAGGGGTGAAGAAATGAGTGAGG + Intergenic
1143394536 17:6581896-6581918 AATGGCTGACTATAAGCCTGGGG - Intronic
1144187496 17:12810058-12810080 GAGGGCTGAGGAATGGCCTGTGG + Intronic
1144623566 17:16833152-16833174 AAGGGCTGACTCACTGCCTGGGG - Intergenic
1144882863 17:18439564-18439586 AAGGGCTGACTCACTGCCTGGGG + Intergenic
1145149368 17:20504822-20504844 AAGGGCTGACTCACTGCCTGGGG - Intergenic
1146696425 17:34911934-34911956 AAGGGCTCACTAGATGGCTGTGG + Intergenic
1147577900 17:41613088-41613110 AAGGGCTGACTCACTGCCTGGGG - Intronic
1148642990 17:49202101-49202123 AAGGGAGGAGGAAAAGCCTGTGG + Intergenic
1150983942 17:70174243-70174265 ATAGGCTGACGAAATGCTAGAGG - Intronic
1152223635 17:79082626-79082648 AAGGGCTGAGAACATCCCTGGGG - Intronic
1157406730 18:47428049-47428071 AAGGGTTGGGGAAATGGCTGAGG + Intergenic
1159460072 18:68713227-68713249 AAGTGCTCAGGAAATGCCTCAGG + Intronic
1161722954 19:5913886-5913908 CAGGGCTGACAAAATTGCTGAGG - Intronic
1162588576 19:11576572-11576594 AAGGGCTGGGGAAGTTCCTGTGG + Exonic
1165122371 19:33568507-33568529 CAGGGAGGACAAAATGCCTGGGG - Intergenic
925031624 2:654234-654256 GAGGGCTGGGGAATTGCCTGTGG + Intergenic
931916591 2:66963147-66963169 CAGGGCTGACAGAATGGCTGGGG - Intergenic
932166337 2:69511110-69511132 AAGGGATGGTGAAATACCTGGGG - Intronic
932310109 2:70732901-70732923 AAGAGTTGCTGAAATGCCTGGGG + Intronic
938067823 2:128291602-128291624 ACAGGCTGACGCCATGCCTGGGG + Intronic
939999418 2:148951903-148951925 GAGGGCTCAGGAAATGACTGGGG - Intronic
940681473 2:156790867-156790889 ATGGGCTGATGAATTGCATGTGG + Intergenic
941555379 2:166973092-166973114 AATGGCTGATGAAATGCAAGTGG - Intronic
943043020 2:182825372-182825394 AAGGGCTGAACAAATACTTGGGG + Intergenic
947312858 2:228823281-228823303 AAGCTCTGAAGAAAGGCCTGAGG - Intergenic
1171432527 20:25092140-25092162 AAGGGCTGATTTAATGCATGTGG - Intergenic
1173577684 20:44123601-44123623 AAGGGCAGGCGGAATGACTGTGG + Intronic
1178681616 21:34677027-34677049 AAGGGCTGACAAAAAGCATGGGG - Intronic
1178720426 21:35004260-35004282 ATGGGATGACAAAGTGCCTGTGG + Intronic
1179185727 21:39083970-39083992 AAGGGCTGATGATATGCAGGTGG - Intergenic
1182875163 22:33685217-33685239 AAGTGCTGAACAAATGCCAGGGG + Intronic
1183777201 22:39974039-39974061 AAGTGCCTACGAATTGCCTGGGG + Intergenic
1184301866 22:43566128-43566150 AAGGGCTCAGCACATGCCTGAGG + Intronic
1184601213 22:45544470-45544492 AAGGGCTGGGGACATGCCTGGGG - Intronic
949231576 3:1756766-1756788 CAGGTCTGGAGAAATGCCTGAGG - Intergenic
953405502 3:42657815-42657837 AAATGCTGAAGGAATGCCTGTGG + Intronic
953920463 3:46948001-46948023 AAGGGCTGCAGAAAAGCCAGCGG + Intronic
957051397 3:75415018-75415040 GAGGGCTGAAGAAAGGCCTCAGG - Intergenic
957454707 3:80426571-80426593 AAAGACTGAAGAAATGCCTCAGG - Intergenic
961303083 3:125934576-125934598 GAGGGCTGAAGAAAGGCCTCAGG + Intronic
962088725 3:132220377-132220399 AAGGGATGAAGACATGGCTGGGG - Intronic
968994179 4:3935397-3935419 GAGGGCTGAAGAAAGGCCTCAGG - Intergenic
972705844 4:41541738-41541760 CAGAGCTTACGAAATGACTGGGG + Intronic
972785809 4:42326024-42326046 AAGAGCTGATGAAATACCTATGG + Intergenic
974318610 4:60314635-60314657 AATGTTTGACCAAATGCCTGGGG - Intergenic
974366952 4:60962555-60962577 AAGGGCTGAGGTACTGCCTTGGG - Intergenic
976257483 4:83113542-83113564 AAGGGCTAAGGAGATGCCTGAGG + Intronic
977772210 4:100872963-100872985 AAGAACTGGTGAAATGCCTGTGG - Intronic
986337575 5:6766795-6766817 AAGGGCTGAGGAGGTGGCTGAGG + Intergenic
988313122 5:29587454-29587476 AAGGGCTGACTTGGTGCCTGGGG - Intergenic
989328596 5:40228699-40228721 AAGGACTGAAGAGAGGCCTGTGG - Intergenic
990330398 5:54719816-54719838 AAGGGCTGGGGAGATGCCTCTGG - Intergenic
995658565 5:114454640-114454662 AAGGGCAGAAGAAATGTTTGGGG - Intronic
997285905 5:132678290-132678312 AAGGGCTTAGGAAATGCTTATGG + Intronic
999246795 5:150159324-150159346 GAGGCTTGACAAAATGCCTGTGG - Intergenic
1003425927 6:5998352-5998374 AGGGGCTGAGGAAATCTCTGGGG - Exonic
1003976806 6:11352233-11352255 AGAGGCTGAAGGAATGCCTGTGG - Intronic
1008570192 6:52809355-52809377 AAAAGCTGAAGAAATGCCTAGGG + Intergenic
1014448622 6:121558144-121558166 CAAGGCTGGCGAATTGCCTGAGG - Intergenic
1015512198 6:134048965-134048987 CAGGCCTGACGAAATTCCAGGGG + Intronic
1017669113 6:156753005-156753027 AAGGGCTGAAGTTATGTCTGAGG + Intergenic
1019352611 7:562038-562060 TGGGGGTGACGAGATGCCTGTGG + Intronic
1020318458 7:6923763-6923785 GAGGGCTGAAGAAAGGCCTCAGG - Intergenic
1032108635 7:129056065-129056087 ACGGGCGGAAGAAATGTCTGGGG + Intergenic
1035929796 8:3767378-3767400 GAGGGCTGAGTAAAGGCCTGAGG - Intronic
1036227543 8:6972179-6972201 CAGTGCTGCGGAAATGCCTGTGG - Intergenic
1036230001 8:6991339-6991361 CAGTGCTGTGGAAATGCCTGTGG - Intergenic
1036232453 8:7010442-7010464 CAGTGCTGTGGAAATGCCTGTGG - Intronic
1036690384 8:10941230-10941252 AAGGGCTGAAGGGTTGCCTGGGG - Intronic
1038725942 8:30082807-30082829 AAGGGCGAACGAAGCGCCTGAGG + Intronic
1038932068 8:32204623-32204645 AATGTCTGACAAAATGCCTGAGG + Intronic
1040728058 8:50407887-50407909 AGGAGCTAACTAAATGCCTGAGG - Intronic
1041831598 8:62161443-62161465 ATGGGCTGAGGAAATTCCTCTGG - Intergenic
1042300517 8:67275448-67275470 AAGGTCTGACAAAATGCCCTAGG - Intronic
1046739878 8:117816559-117816581 AAGGACTGAACAAATGCCAGGGG + Intronic
1060039115 9:120284478-120284500 AAGGGCTGAGGAAGTGACTCAGG + Intergenic
1186616038 X:11188954-11188976 AAGGGCATTCCAAATGCCTGTGG + Exonic
1186629179 X:11330471-11330493 AAGGGTTAACGAGATGCATGTGG + Intronic
1194511497 X:94801359-94801381 AAGGACTGACAAAATCCCTGTGG - Intergenic
1197390792 X:125861313-125861335 AATGTCTGAAGATATGCCTGGGG - Intergenic
1199829767 X:151538078-151538100 AAGGGCTGGAAAGATGCCTGGGG + Intergenic