ID: 1142070490

View in Genome Browser
Species Human (GRCh38)
Location 16:88089069-88089091
Sequence CAGTGGAGGGGGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1456
Summary {0: 2, 1: 1, 2: 14, 3: 151, 4: 1288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142070490 Original CRISPR CAGTGGAGGGGGAAGGAGGC TGG Intronic
900116521 1:1031543-1031565 CAGGGGAAGGGGAACCAGGCAGG - Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900371606 1:2334594-2334616 CCGTGGAGCCGGCAGGAGGCAGG + Intronic
900387769 1:2418412-2418434 CAGTGGAGGGGGCAGGGCTCTGG + Intergenic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900494157 1:2968943-2968965 AAGGGGAGTGGAAAGGAGGCAGG - Intergenic
900623383 1:3597330-3597352 CAGTGGAGGGGTGAGGACCCAGG - Intronic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900968810 1:5977888-5977910 GAGGGGAGGGGGAAGGAGAGGGG + Intronic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901018561 1:6244962-6244984 AGGTGGAGGGGAAAGGAGGGAGG - Intronic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
901319288 1:8329932-8329954 AAGTGGAAGGGGATGTAGGCAGG + Intronic
901404822 1:9038974-9038996 CATTGGAGGGGGCTGGAGGGAGG - Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901478972 1:9511055-9511077 AAGTGTAGGGGAAAGGATGCTGG + Intergenic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901881451 1:12196404-12196426 CACTGGAGTGGGAATGAGGCTGG - Intronic
901922836 1:12548651-12548673 CATTGGAGAGGGAGGGAGGGAGG + Intergenic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902392750 1:16115827-16115849 CAGTGGCGCGGGCAGGAGGCAGG + Intergenic
902408587 1:16199849-16199871 AAGTGGAGGGGAAAGTAGGGAGG - Intronic
902446523 1:16469025-16469047 CAGGGGAGAGGGCAGGGGGCAGG + Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902620293 1:17646839-17646861 CAGTGGCCGAGGGAGGAGGCTGG + Intronic
902754033 1:18537476-18537498 CAGTGGATGGGGAAAGATGCTGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902960119 1:19957384-19957406 TAGTGGAGGGTGAAGGAACCTGG + Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903331706 1:22600042-22600064 GAGTGGAGGAGGAAGGAAGGGGG + Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903616044 1:24657608-24657630 AAATGGAGTGGGAGGGAGGCAGG + Intronic
903654785 1:24942632-24942654 CAGAGGAGTGGGGAGAAGGCAGG - Intronic
903869041 1:26419076-26419098 GAGGGGATGGGGAAGGGGGCGGG + Intronic
903925381 1:26827445-26827467 CCGTGGAGGGGCATGGAGGCTGG - Intronic
904016883 1:27428528-27428550 AGGTGGAGGGGGAGGGAGGAGGG + Intronic
904043970 1:27599451-27599473 GAGTGGAGGGGGCCGGAGCCTGG - Intronic
904053551 1:27655718-27655740 CAGAGGAGGAGACAGGAGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904086967 1:27916183-27916205 AAGGGGAGGGGGCAGGAGGGAGG - Intergenic
904215382 1:28914732-28914754 CAGTGGCGGGCGCAGGAGCCCGG + Intronic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904348711 1:29891078-29891100 CAGTGGCTTGGGAAGGAGTCAGG + Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904774594 1:32899012-32899034 CAGTGCAGGGGGAACCTGGCAGG + Intronic
904836124 1:33338098-33338120 CAGGAGTGGGGGATGGAGGCAGG - Intronic
904879466 1:33684455-33684477 TCGTGGAGGGGGAAGGAAGAAGG - Intronic
904960173 1:34326513-34326535 GAGTGCAGTGGGAAGCAGGCTGG - Intergenic
905075871 1:35269538-35269560 GGGGGGAGGGGAAAGGAGGCAGG - Intronic
905243314 1:36595505-36595527 CAGAGGAGGAGGAAGCCGGCGGG - Intergenic
905289615 1:36912422-36912444 CAGCAGAGGGGGGAGGAGGGGGG - Intronic
905656873 1:39691231-39691253 GAGTGGAGGGGGAGGGGGCCAGG + Intronic
905775122 1:40663457-40663479 CTGGGGAGGGGGGAGCAGGCTGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906077436 1:43062474-43062496 CAGTTGAGGGGCAAGGAAGAAGG + Intergenic
906288568 1:44604334-44604356 CAGTGGAGGGTGGGGCAGGCAGG - Intronic
906560031 1:46749514-46749536 AAGTGGTTGAGGAAGGAGGCAGG - Intergenic
906616190 1:47234468-47234490 GTGTGGAGGGGGAAGGACTCTGG + Intergenic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906747781 1:48233802-48233824 CAGTGGAGATTGGAGGAGGCTGG - Intronic
907046254 1:51302088-51302110 CAGTGGAGGGAGGTGGAGGGAGG - Intronic
907091284 1:51728746-51728768 GAGAGGCGGGGGAAGGAGGGAGG - Intronic
907110526 1:51922588-51922610 CAGTAGAGGTGCAAGGAAGCTGG - Intronic
907303705 1:53502731-53502753 GAGAGGAGAGGGAAGGGGGCAGG + Intergenic
907364316 1:53946409-53946431 CAGTGAAGGTGGGAGGAGGGAGG - Exonic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907437737 1:54460159-54460181 CCTTGGATGGGGAAGGAGGGAGG + Intergenic
907756561 1:57316398-57316420 CATTTGAGGGGGAAGGTGGATGG - Intronic
908170072 1:61495681-61495703 CAGGGGAGGGGGAAGAAGTGGGG - Intergenic
908437523 1:64121195-64121217 CAGGGGAGGAGGAGGGAGGGAGG - Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
909443590 1:75724400-75724422 CGGGGGAGGGGGACGGCGGCGGG - Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909585117 1:77281288-77281310 CAGTGGAGGAGAAAGGTGGGTGG - Intergenic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911161184 1:94684441-94684463 CGGTGGAGCGGGAAGAGGGCAGG - Intergenic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912179680 1:107204781-107204803 CAGGGGTGCGGGTAGGAGGCAGG - Intronic
912625586 1:111203067-111203089 CAGTGGTGGGAGCAGAAGGCAGG - Intronic
912689189 1:111791425-111791447 CAGTCGGGGAGGAAGAAGGCTGG + Intronic
912704955 1:111904815-111904837 CAGTGGAGCGGGGAGGGGACAGG + Intronic
913163114 1:116163219-116163241 CAGTGGAGGGAGATGGAGAGAGG + Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913452471 1:119001397-119001419 CAGGGGAGGGGGAACAGGGCTGG + Intergenic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913939865 1:125091650-125091672 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915246403 1:154558785-154558807 CACGTGAGGGGGACGGAGGCGGG - Intronic
915250542 1:154585204-154585226 CTGTGGATGGGTAAGGAGACAGG - Exonic
915252982 1:154603680-154603702 CACTGGAGGGTGATGGAGCCAGG + Intronic
915304254 1:154968869-154968891 CAGTTGAGTGGGAGGCAGGCAGG - Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915358737 1:155273041-155273063 GAGATGAGGGGGAAGGAGGTCGG - Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915725123 1:158011770-158011792 CAGCAGTGGGGGAAGGAGCCTGG + Intronic
916021674 1:160798128-160798150 CAGTGGAGGGGGCAGGATGTGGG - Intronic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
917202599 1:172533159-172533181 CAGTGGCGGCTGCAGGAGGCGGG + Exonic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918206049 1:182310267-182310289 TAGTGCAGGGTGAAGAAGGCTGG - Intergenic
918273310 1:182924822-182924844 GAGGGGTGGGGGAAGGAGGGAGG + Intronic
918617093 1:186557481-186557503 GAGTGGAGGGAGGAGGAGGGAGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919977995 1:202625457-202625479 GCGGGGAGGGGGAAGGGGGCAGG + Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920101855 1:203521876-203521898 CAGGGGAGTGGGGAGGACGCTGG + Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920572013 1:207024571-207024593 CAGAGGCGGGGGAGGGAGTCAGG - Intronic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921155225 1:212433488-212433510 GAGTGGCGGGGGACGGAGGGAGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921409753 1:214823255-214823277 CAGTGGAGGTGGTGGGAGGGGGG + Intergenic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922362280 1:224834115-224834137 CACAGGAGGAGGAAGGAGGGAGG - Intergenic
922436777 1:225614991-225615013 CCGTGGAGGGAGAGGGAGACCGG - Intronic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922539866 1:226410500-226410522 GAGGGGAGGGGGAAGGGGGGAGG + Intergenic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
922987613 1:229878129-229878151 AAGTGGAGTGGGAGGGAGGGAGG + Intergenic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923554467 1:234989909-234989931 CAGGGGAGGAGGCAGGATGCAGG + Intergenic
923989770 1:239423452-239423474 CTATGGAGGAGGATGGAGGCGGG + Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924275424 1:242381403-242381425 TGAGGGAGGGGGAAGGAGGCAGG + Intronic
924508888 1:244712013-244712035 CTGTGGAGGGGGTAAAAGGCTGG - Intergenic
924539905 1:244970774-244970796 CGAGGGAGGGGGAAGGAGGACGG - Exonic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
1062774662 10:135383-135405 CCGGGGAGGAGGGAGGAGGCCGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063201208 10:3786043-3786065 GACTGGAGGGGGACGGAGACGGG - Intergenic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063493929 10:6489650-6489672 CAGTGGAGGGGCAGGGACCCGGG + Intronic
1063583626 10:7331561-7331583 CAGTGGTGGGTGCAGGAGACAGG - Intronic
1063602992 10:7498814-7498836 AAGAGGAGGAGGAGGGAGGCCGG + Intergenic
1063624501 10:7676568-7676590 CAGTGGTGGGGGAATGGGGGAGG - Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1063953599 10:11246468-11246490 AAGTAGAGGGGAAAGGAGGAGGG - Intronic
1064000018 10:11655714-11655736 TAGTGGACAGGGAAGGAAGCTGG - Intergenic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1065020063 10:21496109-21496131 GAGCGGAGGTGGAGGGAGGCAGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065221638 10:23502035-23502057 AACTGGAGAGGGAAGGAGGGTGG - Intergenic
1065588169 10:27240599-27240621 CGGGGGAGGAGGAAGGAGCCGGG - Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066278007 10:33887647-33887669 GCGTGCAGGTGGAAGGAGGCAGG - Intergenic
1066756323 10:38716395-38716417 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1067073028 10:43150796-43150818 CAAAGAAGGGGGAAGGAGTCAGG - Intronic
1067455333 10:46415067-46415089 CAATGGAGGGAGAAAGTGGCTGG + Intergenic
1067631871 10:47969568-47969590 CAATGGAGGGAGAAAGTGGCTGG - Intergenic
1067862751 10:49869989-49870011 GAGTGGAGGGGAATGGGGGCAGG + Intronic
1068261951 10:54594493-54594515 CAGTGCAGGAGCAATGAGGCAGG - Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069504827 10:68988581-68988603 CAGGGGGCGGGGAAGGAGGTGGG + Intergenic
1069721092 10:70549793-70549815 CATTGGAGAAGGAAGGTGGCTGG + Intronic
1069816025 10:71195080-71195102 AGGTGGAGGGGGCAGGAGGCTGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1069988045 10:72297665-72297687 CGGGGGAGCGGGAAGGAGGGAGG - Intergenic
1070371068 10:75782536-75782558 CTGTGAAGCGGAAAGGAGGCCGG + Intronic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1070920981 10:80186284-80186306 GACTGAAGGGGGAAGGAGGGGGG + Intronic
1070997300 10:80796975-80796997 GAGTGGAGGGAGGATGAGGCTGG + Intergenic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071451486 10:85795655-85795677 AAGTGGAGGAGAAAGGAGACAGG + Intronic
1071568779 10:86685173-86685195 CATTGCAGTGGTAAGGAGGCAGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072766302 10:98097567-98097589 CAGGGGATGGGGAAGCAGGCTGG - Intergenic
1072826679 10:98613736-98613758 TAGGGGAGGGGCAAGGAGGTGGG - Intronic
1073043425 10:100622330-100622352 CATTGGAGGTGTGAGGAGGCAGG + Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074995442 10:118754236-118754258 ACGGTGAGGGGGAAGGAGGCAGG + Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075410325 10:122223019-122223041 GAGAGGAGGAGGAAGGAGACAGG - Intronic
1075517179 10:123118371-123118393 GAGTGGAGGAGGGTGGAGGCGGG + Intergenic
1075656241 10:124163001-124163023 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076318879 10:129564217-129564239 AAGAGGAGGGGGAAGGGGGAAGG - Intronic
1076370553 10:129950033-129950055 GAGGGGAGGGGGGCGGAGGCAGG + Intronic
1076500342 10:130931518-130931540 GAGATGAGAGGGAAGGAGGCAGG + Intergenic
1076668943 10:132108594-132108616 GAGGGGTGGGGCAAGGAGGCAGG - Intronic
1076779657 10:132717239-132717261 CGGGGGTGGGGGAGGGAGGCGGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1076980798 11:203695-203717 CCGAGGAGGGGGAAGCAAGCTGG + Exonic
1076985521 11:233280-233302 CAGTGGGGAGGGCAGGAGTCAGG + Intronic
1077063415 11:627294-627316 CGGCGGAGGGGGCGGGAGGCCGG - Intergenic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077365569 11:2160201-2160223 CCGGGGCGGGGGAAGGAGGTGGG - Intronic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077409232 11:2395724-2395746 CAGCTGAGGAGGAAGAAGGCTGG + Intronic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077523506 11:3050266-3050288 CCGTGCAGTGGGAAGGAAGCAGG - Intronic
1077538071 11:3133953-3133975 GAGTGGCTGGGGAAGAAGGCGGG + Intronic
1077648113 11:3944464-3944486 GAGTGGAGGGGGAAGTGGGATGG + Intronic
1078423120 11:11228578-11228600 CACTGGAGGGGCAGGGAGCCTGG + Intergenic
1078668993 11:13348414-13348436 CAGTGGAGAGGGGATGGGGCTGG + Intronic
1078937291 11:15963185-15963207 CAGTGGTGGGGGAGACAGGCTGG + Intergenic
1079642977 11:22829844-22829866 CAGTGGAGGGCGGTGGGGGCGGG - Exonic
1080236445 11:30074184-30074206 CAATGGACGGGGAAGGAGGTTGG - Intergenic
1080311161 11:30894302-30894324 CCGTGGTGGTTGAAGGAGGCTGG - Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1081604802 11:44520484-44520506 CAGTGGAGGGGAAACCAGGCCGG + Intergenic
1081775962 11:45676103-45676125 CAGTGGAGGAGGGAGGGGGTAGG - Intergenic
1081786223 11:45749764-45749786 AGGTGGGTGGGGAAGGAGGCTGG + Intergenic
1081979459 11:47257553-47257575 CAAGGGAGGAGGAGGGAGGCTGG + Intronic
1082244476 11:49905292-49905314 GAATGGAGGGGGAAGGGGGAAGG + Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1082932958 11:58628227-58628249 CAGTGGAGGTGGGATGAGGCAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083598572 11:63932220-63932242 CAGCGGAGGAGGGAGGAGCCAGG + Intergenic
1083758464 11:64803370-64803392 CAGTGGCGGCGGAAGGACGTAGG - Intergenic
1083842626 11:65313577-65313599 CAGTGGGGGAGGCAGGATGCTGG - Intergenic
1083913044 11:65721016-65721038 GGGGGGAGGGGGAAGGAGGGGGG - Intergenic
1084150865 11:67287340-67287362 CATTGGTGTGGGAAGGAGGGAGG + Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1084944404 11:72631046-72631068 CAGTGGAGGGAGAAGTGGGTGGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1085281153 11:75331670-75331692 CAGTGGAGGGGGATAGGGGTGGG - Intronic
1085315969 11:75545117-75545139 CTGTGGAGGGAGCTGGAGGCGGG + Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085989539 11:81825267-81825289 AAGGTGAGGGGGAAGGAGGGAGG + Intergenic
1086167147 11:83791847-83791869 TGGAGGAGGAGGAAGGAGGCGGG - Intronic
1087153491 11:94879429-94879451 CATGGGAGGGTGAAGTAGGCAGG - Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1088577497 11:111285877-111285899 GGGTGAAGGGGTAAGGAGGCGGG - Exonic
1088908608 11:114173344-114173366 CAGGGGAGGGGAAGGGAGGGTGG + Intronic
1089202077 11:116730643-116730665 GTGTGGAGGGGGAAGAAAGCAGG - Intergenic
1089287223 11:117415441-117415463 TACTGGAGGGGCAGGGAGGCGGG - Intergenic
1089290930 11:117437631-117437653 CAGTAGAGGAGGAAGGGAGCTGG + Intronic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089316905 11:117598145-117598167 CAGTGGAGGAGAAGGGAGGGAGG - Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090022284 11:123138599-123138621 CAGGGGAGGGGGAGGGGGGTGGG - Intronic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090249575 11:125241996-125242018 AGGTGGAGGGGGATGGCGGCGGG + Intronic
1090284241 11:125485341-125485363 CAGTGGAGGAGGGTGGAGACTGG + Intronic
1090588900 11:128244039-128244061 CAGTAGAGGGGAGATGAGGCAGG + Intergenic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091140679 11:133231865-133231887 GAGGGGAGGGAGAAGCAGGCAGG + Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091571533 12:1691137-1691159 GAGGGGAGGGGGGAGGAGGGGGG - Exonic
1091587998 12:1827085-1827107 CCGTGGAGGGCGAAGGAGAGGGG + Intronic
1091638974 12:2219894-2219916 CAGTGGAGGGCCCAGGAGGGAGG + Intronic
1091807344 12:3365984-3366006 CGGGGGCGGGGGAGGGAGGCTGG - Intergenic
1091885394 12:4013530-4013552 AAGTGGAGGGAGAAAGCGGCTGG - Intergenic
1092019206 12:5186463-5186485 TAGAGGAGAGGGAAGAAGGCTGG - Intergenic
1093099271 12:15007875-15007897 CAGTGGAATGGGAAAGAGGTTGG + Intergenic
1093373033 12:18387522-18387544 CAGTGGAGGGTGAAGGGGCGAGG - Intronic
1093850545 12:24031526-24031548 CAGAGGTGGATGAAGGAGGCTGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094692832 12:32786408-32786430 CAGGGGTGGGGGGAAGAGGCAGG + Intergenic
1094698099 12:32841657-32841679 CAGTTAGTGGGGAAGGAGGCAGG - Intronic
1095999654 12:48118691-48118713 CAGTGGGGAGGGATGGGGGCGGG - Intronic
1096077737 12:48815533-48815555 CAGGGGAGAGGGAAGGGAGCAGG + Intronic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096180642 12:49548769-49548791 CAGTGAAGGGGCAAAGCGGCGGG + Intronic
1096212982 12:49780574-49780596 CAAAGGAGGGGGAAAGAAGCAGG - Intergenic
1096532396 12:52250048-52250070 CAGGGGAGAGGGAGGGAGCCAGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096553486 12:52389517-52389539 CATGGGAGCAGGAAGGAGGCGGG - Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096648325 12:53049966-53049988 AAGTGGAGGGGGGAGGATGTGGG - Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096777554 12:53973553-53973575 CGGTGACGGTGGAAGGAGGCAGG - Exonic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097911751 12:64977927-64977949 CAGGGGAGGGGGAATGGGGGAGG - Intergenic
1098191430 12:67953250-67953272 GGGAGGAGGGAGAAGGAGGCTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098385135 12:69910405-69910427 AGGTGGAGGGAGAAGGTGGCAGG + Intronic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1099796972 12:87411654-87411676 TGGTGGAAGGGGAAGCAGGCAGG - Intergenic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100427975 12:94504981-94505003 GAGGGGAGGGGGAAGGAAACTGG + Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101586330 12:106088930-106088952 AAATGAAGGGGGAAGGAGGAGGG + Intronic
1101649110 12:106658799-106658821 GAGTGGAGGTGGTAGGAGGTTGG - Intronic
1101655941 12:106720180-106720202 AGGTGGAGGGGTCAGGAGGCAGG + Intronic
1101965715 12:109280614-109280636 CAATCCAGGGGGAAAGAGGCAGG + Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102045254 12:109825807-109825829 GAGTGGATGGGGCAGGAGTCGGG + Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102367061 12:112346750-112346772 CAGTGGTGGGGAAAGGAGCAGGG + Intronic
1102419355 12:112791697-112791719 CAGTGCAGGGGGAACCAAGCGGG - Exonic
1102428385 12:112862543-112862565 GATTGGAGGGGGCAGGAAGCAGG - Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103425455 12:120830288-120830310 GAGGGGAGGGGGAAGGAGGGGGG + Intronic
1103443665 12:120980503-120980525 CAGGGGAGGGGCAAAGAGTCAGG + Intronic
1103501565 12:121407066-121407088 GGGGGGAGGGGGAAGGAGGGAGG - Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103701331 12:122850243-122850265 CAGTGGAGGGGTTGGGAGGAGGG - Intronic
1103836941 12:123829178-123829200 AAGTTGAGGGGGAAGGTGGTTGG + Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1103975635 12:124700948-124700970 AAGGGGAGCGGGCAGGAGGCTGG + Intergenic
1104004930 12:124885212-124885234 CGGTGGAGGGGGAAGGGAGGAGG - Intergenic
1104172507 12:126295849-126295871 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104786716 12:131455062-131455084 CAGGGGTGGGGGCAGGAGCCAGG - Intergenic
1104914234 12:132256587-132256609 CAGTGGAGGGGGACAGTGGAGGG + Intronic
1104929466 12:132330042-132330064 CGGGGGAGAGGGAGGGAGGCCGG - Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106483503 13:30154251-30154273 CCAGGGAGGGGGAAGCAGGCAGG - Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106943862 13:34803727-34803749 CTTTGCAGGGGGAAGGAGCCTGG - Intergenic
1107213241 13:37884310-37884332 TAGTGGTGGGGGAAGTAGGCAGG - Intergenic
1107432390 13:40351783-40351805 CAATGGAGTAGGAAGGAGGCAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108039338 13:46324725-46324747 TACTGGAGAGGGAAGCAGGCAGG - Intergenic
1108313625 13:49218480-49218502 AAGTGGAGGTGGAGGAAGGCTGG + Intergenic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1108788659 13:53939464-53939486 CAGTGGAGGGGAAAGCAAGCTGG - Intergenic
1109302542 13:60604183-60604205 TACTAGAGGGGGAAGGAGGGAGG + Intergenic
1110259259 13:73467044-73467066 CAGTGGAGAAGGTAGCAGGCTGG + Intergenic
1110369831 13:74727495-74727517 GAGGGGAGGGGAAAGGAGGGAGG + Intergenic
1110627374 13:77666461-77666483 GAGTGGAGGGTGATGGAGGTGGG - Intergenic
1111420537 13:88005208-88005230 CAGTGGTGCGGTAAGGAGGTGGG + Intergenic
1111597235 13:90427745-90427767 CAATGGTGGGGGAAGGTGGGTGG - Intergenic
1111973905 13:94945866-94945888 CAGTGGAGGCGGAGGGGGGTTGG - Intergenic
1112350183 13:98626441-98626463 GAGAGGAGAGGGAAGGAAGCTGG + Intergenic
1112486924 13:99828195-99828217 CTATAGAGGGGAAAGGAGGCAGG + Intronic
1112759089 13:102672731-102672753 AAGAGGAGGGGGAAGGAGGGTGG + Intronic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1113446454 13:110371940-110371962 TCATGGAGGGGAAAGGAGGCAGG + Intronic
1113634867 13:111912656-111912678 TTGTGAAGGGGCAAGGAGGCTGG - Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1114004787 14:18300797-18300819 CTGTGGTGGGGTTAGGAGGCGGG - Intergenic
1114524587 14:23359848-23359870 ATCTGGAGTGGGAAGGAGGCCGG - Exonic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115959291 14:38816878-38816900 TATTGGAGAGTGAAGGAGGCAGG - Intergenic
1116498923 14:45596805-45596827 CAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1117029355 14:51652327-51652349 CAGCGGCGGGGGCGGGAGGCTGG + Intronic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117253107 14:53954525-53954547 AAGTGGCGGGGGAAGGAGTGTGG - Intronic
1117579580 14:57138704-57138726 CAAATGAGGGGGAAGGAGGATGG + Intergenic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118768111 14:68923483-68923505 TAGTGGAGGAGGTAGGAAGCAGG + Intronic
1118777248 14:68980332-68980354 CATTGGAGGAGGATGGAGGGCGG + Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119434455 14:74588893-74588915 CAGTGGGGGTGGAAAGAGCCTGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120517763 14:85490491-85490513 TGGTGGAGTGAGAAGGAGGCTGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120723898 14:87916655-87916677 CAGTGGAGGAAGGAGCAGGCGGG + Intronic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120888296 14:89469291-89469313 CCTTGGAGAGGGGAGGAGGCAGG - Intronic
1121001896 14:90456930-90456952 CCGGGGATGGGGAAGGAGGGAGG + Intergenic
1121265789 14:92601747-92601769 AAGGGGAGGTGGAAGGAGTCAGG - Intronic
1121449964 14:94000947-94000969 AAGTGGAGGGGGCGGGAGGGCGG + Intergenic
1121565744 14:94908151-94908173 CACTGGAGGAGGATGGAGGGCGG - Intergenic
1122055868 14:99097979-99098001 CAGTGAATGGGGAAGAAGGCTGG - Intergenic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1122293733 14:100693606-100693628 CCATGGAGAGGGAAGGAGGAAGG - Intergenic
1122402695 14:101476623-101476645 CATAGGTGTGGGAAGGAGGCAGG + Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122466684 14:101938538-101938560 CACTGGGGCGGGAAGGAGGTTGG - Intergenic
1122558187 14:102592608-102592630 GAGCGGAGAGGGGAGGAGGCAGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122651343 14:103228764-103228786 CAGGGGAGGGGGTGGGAGGGAGG + Intergenic
1122724206 14:103739823-103739845 CCGTGGAGGTGGCAGGAGGGTGG + Exonic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1122935989 14:104956484-104956506 CAGGGGAGGAGCAAAGAGGCTGG - Intronic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1123181666 14:106477137-106477159 CAGTAGACAGGAAAGGAGGCTGG - Intergenic
1202945238 14_KI270726v1_random:19591-19613 CAGTAGACAGGAAAGGAGGCTGG + Intergenic
1123396224 15:19939793-19939815 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1123440587 15:20288467-20288489 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124578047 15:30926740-30926762 CGCTGGAGGAGGAAGCAGGCTGG + Intronic
1124614833 15:31234102-31234124 GGATGGAGGGGAAAGGAGGCTGG + Intergenic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124847153 15:33302266-33302288 CAGTAGAGGGGCAATGCGGCAGG + Intergenic
1125485693 15:40109236-40109258 AAGGGAGGGGGGAAGGAGGCGGG + Intergenic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1126096359 15:45093627-45093649 CATTTGAGGGAGGAGGAGGCTGG - Exonic
1126102811 15:45129899-45129921 CAGTGGGGCGGGATGGAGTCTGG - Intronic
1126460734 15:48912981-48913003 CAGTGGAGGGGGTGGGGTGCAGG + Intronic
1127010208 15:54617355-54617377 AAGTGGAGGGGCAGGGAGGAGGG + Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127905659 15:63374043-63374065 AGGTGGAGGGGGAAGGATGGAGG - Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128336807 15:66791937-66791959 CAGTGGGGAGGGATTGAGGCTGG - Intergenic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1128992730 15:72273902-72273924 GAGTGGTAGGGGAAGGAGTCAGG + Intronic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129191270 15:73939073-73939095 CAGTGTAGGAGTAAGGAGGCTGG - Intronic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129235714 15:74222704-74222726 AAGTGGAGGGGAAAGGAGAGCGG + Intergenic
1129288765 15:74547153-74547175 CGGGGGAGGGGGAAGGCGGGGGG - Intronic
1129455089 15:75672486-75672508 CACTGGTGGGGGAAGGGGACAGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129538452 15:76332900-76332922 GAATGGAGGGGGATGGAGCCTGG + Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129892869 15:79083168-79083190 CAGTGAAGGAGGCTGGAGGCTGG + Intronic
1130146179 15:81275343-81275365 CAGTTGACGGGGGAGGAGGGGGG + Intronic
1130381939 15:83379052-83379074 GAGTGGTGGGGGGAGGGGGCGGG + Intergenic
1130542940 15:84835059-84835081 CAGGGGTGGGGCAAGGAGGGAGG - Intronic
1130632498 15:85582794-85582816 CAGTGCAGGGGATAGGATGCAGG + Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131367722 15:91853893-91853915 CGGCGGCGGGGGAAGGATGCAGG + Exonic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133200370 16:4200510-4200532 GAGTGCAGGGGCAAGGAAGCGGG + Intronic
1133280194 16:4660778-4660800 CAGTGGAGTGGGCAGGAAACAGG + Intronic
1133311117 16:4847478-4847500 GAAGGGAGGGGGAAGGAGCCGGG - Intronic
1133611942 16:7441828-7441850 CAGTGGATCGTGAAGCAGGCTGG - Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134122791 16:11596678-11596700 GAGGGGAGGGGGAAGGAGCAGGG + Intronic
1134375318 16:13666756-13666778 CAGTGGAGGAGGAAAGAGAGGGG + Intergenic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135708701 16:24696773-24696795 AAGGGGAGGGGGAGGGAGGGAGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136019321 16:27430019-27430041 CAGTGGAGGGTGAGCCAGGCGGG - Intronic
1136138863 16:28276054-28276076 AAGTGGAGGAGGAGGGAGGCTGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136569466 16:31088112-31088134 CAGTGGCGGGGGCAGGAGTTGGG - Intronic
1136698695 16:32111945-32111967 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136726254 16:32359897-32359919 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1136768909 16:32815884-32815906 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1136799198 16:33055241-33055263 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136844597 16:33565976-33565998 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137724171 16:50645951-50645973 CAGGAGAGGGGAAAGGAGGGAGG + Intergenic
1137759577 16:50929272-50929294 CAATGGAAGTGGGAGGAGGCAGG - Intergenic
1138195757 16:55050996-55051018 CCTTGGAGTGGGAAGGAGGAGGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138350222 16:56342390-56342412 CTGTGGAGGGGGCAGCAGGGAGG - Intronic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138495276 16:57405122-57405144 GACTGGATGGGGAAGGAAGCAGG + Intronic
1138756364 16:59490938-59490960 CAGGGGAGGGGGAGGAAGGAGGG - Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139348919 16:66323117-66323139 CAGTTGAGCTGGAAGGGGGCAGG - Intergenic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1139497244 16:67328819-67328841 CAGTGTAGGGGGTTGGAGGTGGG - Intronic
1139512563 16:67435875-67435897 CAGGGGAGTGGGAAGGACACGGG + Intronic
1139631422 16:68234168-68234190 GAGGGTAGGAGGAAGGAGGCAGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140219380 16:73032928-73032950 CAGTGGAGGGGGTTTCAGGCAGG + Intronic
1140277501 16:73523585-73523607 CAGTGCTGGGGGTAGGGGGCAGG + Intergenic
1140357580 16:74319429-74319451 CATCTGAGTGGGAAGGAGGCTGG - Intergenic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140792800 16:78408419-78408441 CAGTGGAGAGGGAATGTGGTGGG - Intronic
1140818227 16:78639928-78639950 CTGTGGAGGGAGTGGGAGGCAGG + Intronic
1140953962 16:79845311-79845333 CAGTGCAGCAGGAAGGAGGTCGG + Intergenic
1141513137 16:84525382-84525404 GAGCGGAGGGGGAGGGAGGATGG - Intronic
1141519369 16:84567479-84567501 ACGTGGAGGTGGAAGGAGACAGG + Intronic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141670217 16:85487737-85487759 CGGTGGTGGGGGAAGGAGGTGGG + Intergenic
1141815044 16:86404094-86404116 CAGTGGAGCAGGCAGGAGTCAGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142155686 16:88531979-88532001 CTGTGGGGTGGGAAGCAGGCGGG - Intronic
1142175187 16:88642007-88642029 AAGGGGAGGAGGAAGGAGCCAGG + Intergenic
1142285677 16:89170626-89170648 GGGTGGAGGGGGCTGGAGGCAGG - Intergenic
1203000178 16_KI270728v1_random:157859-157881 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203071326 16_KI270728v1_random:1077995-1078017 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1203131779 16_KI270728v1_random:1694262-1694284 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203154764 16_KI270728v1_random:1866274-1866296 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1142514286 17:416895-416917 GAGTGGAGCAGGAAGGAAGCCGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142759466 17:2034631-2034653 CAGGGGAGGGGGAAGGGGAGGGG - Intronic
1142889256 17:2932361-2932383 CAGTGGAGGAGGAGGGAGACTGG + Intronic
1142962379 17:3558855-3558877 CTGGGGAGGAGGCAGGAGGCAGG + Intergenic
1142982149 17:3678556-3678578 CAGCAGTGGGGCAAGGAGGCTGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143373778 17:6455687-6455709 CAGCGCAGGGGGAAGAAGGGAGG + Intronic
1143503352 17:7351418-7351440 CGGTGGCGGGGAAGGGAGGCAGG - Exonic
1143510621 17:7393581-7393603 CAGGTGAGTGGGAAGGAGGGAGG - Exonic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143592558 17:7894379-7894401 CGGTGGAGGGATAAGGAAGCAGG - Intronic
1143679232 17:8463996-8464018 CACTGGAGAGGGCAGGAGGGTGG - Intronic
1143732021 17:8886762-8886784 CAGGTGAGGGGCATGGAGGCTGG - Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144559963 17:16312915-16312937 GAGGGGAGGGGGAAGGGGGGGGG + Intronic
1144644707 17:16964264-16964286 GAGTGGAGGTGGGAGCAGGCAGG - Intronic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144943638 17:18958853-18958875 CAGTGGAGCAGGCCGGAGGCTGG + Intronic
1145056378 17:19706506-19706528 CAGTGAAGCTGGAAGGGGGCTGG + Intronic
1145692848 17:26762195-26762217 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1145969767 17:28950068-28950090 CACTGGAGGTGGAAGGCAGCCGG + Exonic
1146003687 17:29147568-29147590 AAGAGGAGGAGAAAGGAGGCTGG + Intronic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146178115 17:30679608-30679630 CAGAGGAGGGGGGAGGACGGGGG + Intergenic
1146178138 17:30679670-30679692 CAGAGGAGCAGGAAGGAGGGGGG + Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146594535 17:34157318-34157340 CTGGGGCGGGGGAAGCAGGCAGG - Intronic
1146672740 17:34753008-34753030 TAGCGAAGAGGGAAGGAGGCAGG - Intergenic
1146682162 17:34816206-34816228 CAGTGGGGTGGGGAGGGGGCTGG - Intergenic
1146727710 17:35169586-35169608 AAATGGTGGGGGAAGGGGGCAGG + Intronic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147313355 17:39607416-39607438 CGGTGGTGGGGAAAGGTGGCAGG + Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147441935 17:40452804-40452826 CAGGGGAGAGGGGAGGAGGTAGG + Intronic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147727380 17:42574708-42574730 AAAGGGAGGGGGAAGGAGGGAGG - Intronic
1147847552 17:43415457-43415479 CAGTGGAGAGTGTAGGAGGCAGG + Intergenic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148216865 17:45838041-45838063 CAGTGGTGGGGGAAGGTCGCTGG + Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148758263 17:49985959-49985981 GAATGGAGGGGGAAGGAGAAGGG - Intergenic
1148847587 17:50538369-50538391 CAGTGGAGAGGACTGGAGGCAGG - Intronic
1149018709 17:51938342-51938364 CAGTCGAGGGTGAAGGATCCAGG + Intronic
1149394081 17:56221078-56221100 AGGTGAAGGGGGAAGCAGGCAGG + Intronic
1149449804 17:56740680-56740702 CTTTGGTGGGGGAAGGAAGCTGG + Intergenic
1149496088 17:57118467-57118489 CAGGGGTGGGGGAGGCAGGCTGG + Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149867120 17:60157194-60157216 CAGTGGAGGGTGCAGGAGAGGGG + Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1149965226 17:61155871-61155893 GAGTGGAGAGGGAAGAAGGAGGG - Intronic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1149992460 17:61390585-61390607 GAGTGGAGTGGGGAGGAGGCGGG - Intronic
1150041245 17:61863522-61863544 GAGTCGAGGGGGCGGGAGGCGGG - Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150583638 17:66498137-66498159 CGGGGCAGGGGGCAGGAGGCGGG - Intronic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1151145230 17:72034394-72034416 GAGAGGAGGGGGAAGCAGGAGGG - Intergenic
1151259810 17:72907685-72907707 GAGTGGAGTGGGATGGAGGTGGG - Intronic
1151393080 17:73801087-73801109 CACTGGAGGTGGGAGGAGGCTGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151826585 17:76527308-76527330 CAGAGGTGAGGGAAGGTGGCAGG + Intergenic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152238026 17:79148522-79148544 CAGTGGCCGGGGACAGAGGCAGG - Intronic
1152253813 17:79225923-79225945 CAGTGGTGGGGGAAGCAGGATGG + Intronic
1152408255 17:80109442-80109464 CAGAGGAGGAGGTGGGAGGCAGG + Intergenic
1152576765 17:81144509-81144531 CAATGGAGGGGCAAGGGGGCCGG + Intronic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152913077 17:83016606-83016628 AAGAGGAGGGGGGAGGAGGGAGG + Intronic
1152931088 17:83110199-83110221 TGGGGGAGGAGGAAGGAGGCCGG + Intergenic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1153934228 18:9906482-9906504 CAGTGGAGTGGGCATGAGACAGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154112180 18:11579538-11579560 CAGTGGACGTGGAGTGAGGCTGG - Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156452687 18:37275385-37275407 CGGGGGAGGGGGACGGGGGCGGG + Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156560767 18:38122991-38123013 CATTGTTGGGGGTAGGAGGCAGG + Intergenic
1157257261 18:46150379-46150401 ATGTGGAGGTGGGAGGAGGCTGG - Intergenic
1157516943 18:48317969-48317991 CAGGGGGTGAGGAAGGAGGCAGG - Intronic
1157540912 18:48505822-48505844 CAGTGGAGGTGGTGGGAGGGTGG - Intergenic
1157544628 18:48539254-48539276 CGGGGGTGGGGGAAGGGGGCAGG - Exonic
1157600772 18:48891937-48891959 GGGAGGAGGGGGCAGGAGGCCGG + Intergenic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1158543081 18:58374467-58374489 CAGTGGGGTGGGGAGGAGGCCGG - Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158851022 18:61495992-61496014 GAGGGGAGAGGGAAGAAGGCGGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159019461 18:63131482-63131504 CAGTGGGGCAGGAAGGAGTCAGG + Intronic
1159031215 18:63234236-63234258 TATTGGAGGGGGCAGGAGGAGGG - Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159409698 18:68055226-68055248 TGCTGGAGGGGGAAGGAGGAAGG - Intergenic
1159586659 18:70288987-70289009 AGGAGGAGGAGGAAGGAGGCGGG + Exonic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1159845099 18:73449686-73449708 CAGTGGTGGGGGAATGAGGGTGG - Intergenic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1160771930 19:835888-835910 AAGAGGAGAGGAAAGGAGGCCGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1160863062 19:1245739-1245761 AAGTGGAGGGGGAGCCAGGCAGG - Intergenic
1160866247 19:1257483-1257505 GAGTGAAGGGTGAAGGAGGTAGG - Exonic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1160965665 19:1746010-1746032 AGGAGGAGGGGGAAGGAGGGGGG + Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161022287 19:2015896-2015918 GAAAGGAGGGGGAAGGAGGGAGG + Intronic
1161022304 19:2015934-2015956 GAAAGGAGGGGGAAGGAGGGAGG + Intronic
1161022321 19:2015972-2015994 GAAAGGAGGGGGAAGGAGGGAGG + Intronic
1161022338 19:2016010-2016032 GAAAGGAGGGGGAAGGAGGGAGG + Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161522034 19:4730087-4730109 GGGTGGAGGAGGGAGGAGGCTGG - Intergenic
1161644677 19:5445726-5445748 CAGAGGAGGAGGGAGGAGGGAGG + Intergenic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162012079 19:7823479-7823501 GAGGGGAGGGGGATGGAGGGGGG + Intergenic
1162363950 19:10236588-10236610 CAGTGGAGGAGGAAGGAAACAGG + Intergenic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162614255 19:11784519-11784541 CTGAGGAGGGGGAATGAGTCAGG + Intergenic
1162702092 19:12524023-12524045 CAGTGAAGGGGGGAGGAGACAGG + Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162777767 19:12990184-12990206 GAGTGATGGGGGATGGAGGCAGG - Intergenic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162885498 19:13694025-13694047 CACTGGAGGGGCAAGGGAGCTGG + Intergenic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163476145 19:17527176-17527198 CAGGGGAGTGGGGAGGACGCAGG + Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163527477 19:17830458-17830480 GCGTGGAGGGAGAAGAAGGCTGG + Intronic
1163647119 19:18495750-18495772 CAGTGGAGGGATGGGGAGGCAGG + Intronic
1163663857 19:18594163-18594185 CAGGGGAGGGGGAAGACAGCAGG - Intronic
1163779570 19:19239439-19239461 GAGAGGAGGGGGAGGGAGGATGG - Intronic
1164022586 19:21321631-21321653 GAGGGGAGGGGGAAGGAGGGAGG + Intronic
1164669682 19:30065304-30065326 CAGGTGTGGGGGGAGGAGGCAGG + Intergenic
1164685074 19:30161211-30161233 CAATGGAGGAGGAAAGAGGGTGG - Intergenic
1164742874 19:30589717-30589739 CAGTGGAGCAGCAAGGAAGCTGG + Intronic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165389597 19:35530674-35530696 CAGAGGAGAGGGACTGAGGCTGG - Intergenic
1165605901 19:37104122-37104144 CGGGGGAGGGGGAAGGGGGGAGG - Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165907469 19:39202855-39202877 CAGGGGAGGTGGGAGGGGGCAGG + Exonic
1165984465 19:39755914-39755936 GAGTAGAGGGGGAAAGAGGTAGG - Intergenic
1166361265 19:42253918-42253940 CGGGGGAGGGGGAAGGGGGCCGG - Intronic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166719293 19:44988227-44988249 GAGGGGAGGAGGAAGGGGGCAGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166966481 19:46532151-46532173 CTGTGCAGTGGGAAGTAGGCGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167383759 19:49152523-49152545 CAGGGGAGGGGAGGGGAGGCTGG - Intronic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167505132 19:49867275-49867297 TAGTGGATGTGGGAGGAGGCGGG - Intronic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167618609 19:50549387-50549409 GAGTGGAGGGGAGAGGAGGCTGG - Intronic
1167648688 19:50718720-50718742 GAATGGAGGCGGAGGGAGGCGGG + Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167743327 19:51337573-51337595 GAGGGGAGAGGGAAGGGGGCTGG + Intronic
1167750828 19:51379299-51379321 CAGGGGAGGAGAGAGGAGGCTGG + Intergenic
1168252615 19:55149093-55149115 TGGGGGAGGGGGCAGGAGGCAGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
1168296679 19:55380365-55380387 GAGGGGAGGGGGAAGCAGGGAGG - Intronic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925339722 2:3127769-3127791 CAGTGGAGGGTGGAGGACGGAGG + Intergenic
925390461 2:3490571-3490593 GAGTGGATGGGGAAGGATGGAGG - Intergenic
925755508 2:7128299-7128321 AAGGGGAGGGGGAAGGGGGGAGG - Intergenic
925851775 2:8088712-8088734 CATTCCAGAGGGAAGGAGGCAGG + Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926148800 2:10413166-10413188 CAGGGGAGGAGGAAGGACTCTGG - Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926633858 2:15160591-15160613 GAGGGGGGGGGGCAGGAGGCTGG + Intergenic
926704291 2:15825909-15825931 CATGGGAGGGGGCAGGAGGTGGG + Intergenic
926884946 2:17588436-17588458 CATATGAGGGGGAAGCAGGCTGG - Intronic
926918550 2:17916630-17916652 CAATGGAGGGGGAATGAAGCAGG - Intronic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927312961 2:21651163-21651185 TAGTCGATGGGGAAGGAGGCAGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927849453 2:26489739-26489761 TACTGGAGGGGGAAGGATCCAGG + Exonic
927889626 2:26740188-26740210 AAGTTGAGGGGGCAGGGGGCGGG + Intergenic
927962711 2:27250706-27250728 GAGTGGAGGGAGAGAGAGGCAGG - Intergenic
927997803 2:27498340-27498362 AAGTGGAGGGGGAAGAAAACTGG - Intronic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928245450 2:29622716-29622738 CAGAGGAGGGGTGAGGGGGCTGG - Intronic
928410833 2:31052655-31052677 CAGTGGAGGCTGATTGAGGCTGG - Intronic
929045543 2:37785473-37785495 AAGTGGATGTGGAAGCAGGCAGG - Intergenic
929275065 2:40016034-40016056 TACTAGAGGGGGAAGGAGGGAGG + Intergenic
929426771 2:41851813-41851835 CACTGGAGGTGGGAGGAGGTGGG + Intergenic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929467039 2:42154384-42154406 AAGTGATTGGGGAAGGAGGCTGG + Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
930273750 2:49286746-49286768 CAGTGGTGGTGGATGAAGGCTGG + Intergenic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931052211 2:58428039-58428061 CGGGGGAGGGGGAAAGAGGGAGG + Intergenic
932143109 2:69296955-69296977 CAGAGGAGGGGGTACCAGGCCGG - Intergenic
932750979 2:74371536-74371558 CCTTGGATGGGGAAGGAAGCGGG + Exonic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934319622 2:91960653-91960675 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934767179 2:96886186-96886208 GAGTGTAGGGGACAGGAGGCTGG - Intronic
934916293 2:98303286-98303308 GGGTGGAGGGGGAAGGATACTGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935014168 2:99164305-99164327 GAGTGGAGAGGGGAGGAGGGGGG - Intronic
935039772 2:99415064-99415086 CGGAGGTGGGGGAGGGAGGCAGG + Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935879297 2:107544958-107544980 GAGTGGAGATGGAAGGAGACTGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936469799 2:112788933-112788955 GAGAGGAGGGGGAAGGAGTGAGG + Intergenic
937198292 2:120179896-120179918 CAGTGGAGGTGGAGGGAGTGTGG + Intergenic
938134940 2:128749102-128749124 CAGTGGAGGTTGAAGAATGCGGG + Intergenic
938301132 2:130213728-130213750 CAGTGGCGGGGGCAGCGGGCAGG - Intergenic
938425372 2:131182075-131182097 AAGAGGAGGGGGGAGGAGGGAGG + Intronic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
939517074 2:143182343-143182365 CAGAGGAGAGGGAAAGAGACAGG + Intronic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
942098484 2:172555964-172555986 ACGCGGAGCGGGAAGGAGGCGGG - Intronic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
943921499 2:193713197-193713219 AAGGGGAGGGGGAAGGAGAGGGG - Intergenic
944034569 2:195278211-195278233 CAGTGGACTGGGAGAGAGGCAGG - Intergenic
944135814 2:196398087-196398109 GAGTGTAGGGGAAAGGTGGCTGG + Intronic
944285697 2:197947557-197947579 CAGTGGTGGGGAATGTAGGCTGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
945151999 2:206801359-206801381 TGGTGATGGGGGAAGGAGGCTGG + Intergenic
945606833 2:211943652-211943674 AAGTAGAGGGGGAAAGAGGCAGG - Intronic
945844368 2:214926746-214926768 CAGTGGAGGGGGGCGGGGGCAGG + Intergenic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946396848 2:219447695-219447717 CAGGGCTGGGGGGAGGAGGCTGG + Intronic
946400391 2:219465414-219465436 CAGAGGAGGGGAACTGAGGCAGG - Intronic
946410015 2:219511106-219511128 GGGTGCAGGGGGAGGGAGGCTGG + Intergenic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946921496 2:224585414-224585436 GGGTGGAGGGGGGAGGAGGGAGG + Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947464148 2:230326389-230326411 CATTGGAGGAGGATGGAGGTTGG - Intergenic
947473052 2:230415424-230415446 CATTGGAGGAGGATGGAGGTTGG - Intergenic
947589901 2:231379575-231379597 TGGGGGAGGGGGAGGGAGGCAGG + Intergenic
947808997 2:232988166-232988188 CAGTGGTGGGGGAGGGAGCAGGG - Intronic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948125077 2:235558594-235558616 CAGTGTGGGGGAAAGTAGGCTGG - Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948233218 2:236366794-236366816 GAGAGGAGGAGGAAGGAGGGAGG - Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948598876 2:239096940-239096962 CAGGGCAGGAGGCAGGAGGCAGG + Intronic
948698369 2:239745514-239745536 GGATGGAGGGGGAAGGAGACAGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1169328552 20:4697758-4697780 CAGGGGAGGAGCAGGGAGGCTGG + Intronic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1170199282 20:13725108-13725130 CACTGGAGGGGGCAGGGTGCAGG - Intronic
1170204717 20:13785410-13785432 CAGTAGAGGCCGAAAGAGGCAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1170742027 20:19066610-19066632 CAGGGGTGGGGGAAGGGGGATGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171184834 20:23117868-23117890 CTGGGGAGGGGTCAGGAGGCAGG + Intergenic
1171364522 20:24614637-24614659 GAGGGGAGGGGAAAGGAGGGAGG + Intronic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172160014 20:32861259-32861281 CAGTGGAGTGGGTAGGATGGTGG - Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173183497 20:40821710-40821732 CTGTGGAGGAGAAAGCAGGCAGG + Intergenic
1173454721 20:43192666-43192688 CAGTGCTGAAGGAAGGAGGCAGG + Intergenic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1173571415 20:44079166-44079188 CAGGGGAGGAGGAAGGAGCTTGG - Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173663375 20:44749448-44749470 CAGTGGAGGGGGAGGTAGTCAGG + Intronic
1173748115 20:45453530-45453552 GAGAGGAGGGGGTAGGAGGTAGG + Intergenic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1173792141 20:45834471-45834493 GAGTGCAGGAGGACGGAGGCGGG + Intronic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1173941347 20:46913795-46913817 CAGTGGAGGGAGGAGCAGGTTGG + Intronic
1174305086 20:49609340-49609362 GAGTGGAGAGGGGAGGAGGTAGG + Intergenic
1175179804 20:57137787-57137809 CAGTTGAGGGGTGGGGAGGCAGG + Intergenic
1175185483 20:57177209-57177231 GGGTTGAGGAGGAAGGAGGCAGG + Intronic
1175306782 20:57981694-57981716 GAGGGGTTGGGGAAGGAGGCAGG + Intergenic
1175367911 20:58467971-58467993 CAGCGGGGGAGGAAGCAGGCAGG - Intronic
1175602643 20:60287479-60287501 AAGTGGAGGTGGAAGGAGGGAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175690893 20:61065430-61065452 CAGTGGAGGGGTCTGGAGGAAGG + Intergenic
1175745204 20:61451706-61451728 AGGAGGAGGGGGTAGGAGGCTGG + Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1175990260 20:62785250-62785272 CAGAGGTGGGGGATGGAGGGTGG + Intergenic
1176107364 20:63395732-63395754 GAGTAGAGAGGGAAGAAGGCAGG + Intergenic
1176109197 20:63403894-63403916 AAGTGCAGCGGGAAGGAGGCTGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176136181 20:63522981-63523003 CAGTGGTGGGGGAGGGACTCTGG + Intergenic
1176162208 20:63653596-63653618 CGGGGGCGGGGGAAGGAGGGAGG + Intergenic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178043011 21:28662370-28662392 CAGCGGAGGGGGAAAGAGGGAGG - Intergenic
1178466547 21:32853654-32853676 CAGTGGAGAGGGAACATGGCGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179254747 21:39705778-39705800 CAGTGGAGTGGGAAGAGGACAGG + Intergenic
1179411606 21:41167596-41167618 CGGTGGATCGGGAAGGAGCCTGG - Intergenic
1179444276 21:41420484-41420506 CAGGGGGCGGGGAAGGGGGCAGG - Intronic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179812990 21:43884270-43884292 AGGAGGAGGGGGAAGGAGGAGGG - Intronic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1180012607 21:45060696-45060718 CAGGGGAGGGCGATGGAGGGAGG + Intergenic
1180307873 22:11144698-11144720 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1180546349 22:16506511-16506533 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1181015472 22:20066185-20066207 CACTGGAGCGGGAGGCAGGCTGG + Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182212844 22:28690868-28690890 GAGGGGAGGGGGAAGGAAGGAGG + Intronic
1182355961 22:29722302-29722324 CAGTGCAGGGGCAAGGCCGCAGG + Intronic
1182585505 22:31342389-31342411 CAGTGGGGGAGGTAGGAGGTAGG - Intronic
1182657161 22:31899897-31899919 GAGTGGAGGGGGAAGGGTGGAGG - Intronic
1182850978 22:33473994-33474016 CTTTGGAGGGGAAAGGAGGTTGG + Intronic
1183094302 22:35542876-35542898 CAGCGGAGCGGAAAGGGGGCAGG - Intronic
1183126794 22:35789873-35789895 GAGTTGAGGGGGTAGGTGGCAGG + Intronic
1183278083 22:36913864-36913886 CAGTGGATGGGGAGGCAGCCAGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183650289 22:39149707-39149729 CAGGGGAGGGGGCAAAAGGCAGG + Intronic
1183724009 22:39578493-39578515 CAGGGGAGGAGGAGGGAGGGTGG - Intronic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1183894876 22:40960250-40960272 GAGTTGAGGGGGAAGGAGGGAGG + Intronic
1183956300 22:41382307-41382329 CAGCGGAGGGGGATGGGGCCTGG + Intronic
1184075314 22:42173375-42173397 CAGGTGGGGGGGAAGGTGGCAGG + Intronic
1184175918 22:42788623-42788645 CAGTGGCCGGGGAAGTTGGCGGG + Intergenic
1184247990 22:43245324-43245346 CAGTGGAGGTAGAGGCAGGCGGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184587799 22:45459535-45459557 GGGTGGAGGGAGAAGGAGCCAGG + Intergenic
1184617941 22:45650731-45650753 CAGTGGAGAGTAAAGGAAGCGGG + Intergenic
1184649592 22:45913494-45913516 CAGGGGTGGGGAAAGGAGCCAGG - Intergenic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184751049 22:46487008-46487030 AAGTGGAGGGGGCAGGGGGCGGG - Intronic
1184843335 22:47065520-47065542 CAGGGGAGGGGCAGGGAGCCAGG - Intronic
1185135630 22:49070447-49070469 CTGTGGTGGGGAGAGGAGGCTGG + Intergenic
1185185299 22:49395720-49395742 GAGAGGAGGGGGACGGAGGGGGG - Intergenic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1203300616 22_KI270736v1_random:74487-74509 CAGTGGAGGGGAAAGGAGTGGGG + Intergenic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
949986640 3:9546400-9546422 CCCTGGAGGTGGGAGGAGGCAGG - Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950176704 3:10880027-10880049 TAGTGCAGGTGGAAGGTGGCTGG + Intronic
950222776 3:11208988-11209010 CAGTTGAGGGTGAAGGAAACTGG - Intronic
950390638 3:12693912-12693934 AGGTGGAGGGAGAAGCAGGCTGG + Intergenic
950528232 3:13537025-13537047 CAGTGGAGGAAGCAGGAGTCGGG + Intergenic
950530281 3:13549065-13549087 CAGGGGAGGGGGCCGGGGGCCGG + Intergenic
950884671 3:16353036-16353058 CACAGGAGGAGGAAAGAGGCAGG + Intronic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
951923906 3:27886494-27886516 CAGGGGTGGGGGCAGGAGGGAGG - Intergenic
952706164 3:36380314-36380336 CGCAGGAGGAGGAAGGAGGCGGG - Intergenic
953019583 3:39104999-39105021 GAGTGGGGAGGGAAGTAGGCAGG - Intronic
953282465 3:41572411-41572433 CAGTGGTGGGGGGAGGGGACAGG - Intronic
953384554 3:42499234-42499256 TGGTGGAGTGGGAAGGGGGCTGG - Intronic
953393190 3:42545670-42545692 CAGTGGTGGGGGAAGGGGCGGGG - Intergenic
953413721 3:42703742-42703764 CAGTTGAGGAGGCAGGAGGGAGG + Intronic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953769152 3:45765499-45765521 CAGTGGAGGAGGCAGGGGTCAGG - Intronic
953853127 3:46480980-46481002 CAGTGGAGGAGGGTGGAGGCTGG - Intronic
953912230 3:46898947-46898969 CAGTGGCGCTGGCAGGAGGCGGG - Intronic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
954762558 3:52887263-52887285 CTTGGGAGGTGGAAGGAGGCTGG - Intronic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955721533 3:61886556-61886578 CAGTGGAGGTGGCAAGGGGCAGG - Intronic
956491328 3:69775079-69775101 CAGATGAGGGGCAAGGAGGTGGG - Intronic
956492150 3:69784599-69784621 TGGGGGAGGGGGAAGGAGGGAGG - Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
958514257 3:95092239-95092261 AAGTGGCGAGGGAATGAGGCAGG + Intergenic
959370229 3:105514731-105514753 AAGTGGTGGGGGGAGGAGGAAGG + Intronic
959653652 3:108776372-108776394 CAGTGGGGGGAGAAGGATCCAGG + Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960061212 3:113323465-113323487 GAGTGGTGAGGGAAGGAGGGGGG + Intronic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960554267 3:119010273-119010295 CAGTGGAGTGAGAAGGTTGCTGG - Intronic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960884935 3:122384168-122384190 CGTTGGAGTGGGAAGGACGCAGG - Exonic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961132590 3:124482912-124482934 CAGTGGAGGGGGATGTAGAGGGG - Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
962481644 3:135803215-135803237 TAGCGGAGGGGGAAGGGGACAGG - Intergenic
963631204 3:147732387-147732409 CAGGTGGGGAGGAAGGAGGCAGG - Intergenic
963770618 3:149382704-149382726 GGGTGGTGGGGGAAGCAGGCAGG - Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
965742794 3:171893843-171893865 AAGGAGAGAGGGAAGGAGGCAGG - Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966437829 3:179908336-179908358 CAGTGGAGGAGAAAGTAGGAAGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966638131 3:182158127-182158149 CAGTGGAGGGGCACGGAGGCTGG + Intergenic
966660341 3:182407791-182407813 AAGTGGAGTGGGAAGGAGTGGGG + Intergenic
966881214 3:184352333-184352355 TAGTAGAGAGGGAGGGAGGCTGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966931897 3:184680840-184680862 GAGTGGTGGGGGGAGCAGGCAGG + Intronic
967073707 3:185983677-185983699 TAGTGGTGGGAGAAGGAAGCTGG - Intergenic
967186685 3:186950113-186950135 CTGTGGAGGGAGCTGGAGGCAGG + Intronic
967429570 3:189366174-189366196 CAGGGGTGGGGGTAGGAGGAAGG - Intergenic
967788409 3:193521979-193522001 CTGTGGAGGGGGAAAGATGGAGG - Intronic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968612511 4:1563648-1563670 CACTGGAGGAGCAAGGAGCCTGG + Intergenic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968952006 4:3700217-3700239 GAGTGGAGGGGGAGGGGGGGAGG + Intergenic
969139429 4:5055671-5055693 CAGACGAGCAGGAAGGAGGCAGG - Intronic
969232224 4:5839757-5839779 CTGTGGAGGGAGAACGGGGCTGG + Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969444207 4:7234891-7234913 CAGTGCTGGGGCCAGGAGGCCGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969717926 4:8877401-8877423 AAATGGAGGGGGAAGGAGAGAGG + Intergenic
969979030 4:11135105-11135127 CAGTGGAGGGGAGGGGAGGGAGG - Intergenic
970044331 4:11833528-11833550 GAGAGGTGGGGGAAGGAGGGAGG - Intergenic
970333197 4:15004379-15004401 CATGGGCGGGGGACGGAGGCGGG + Intronic
970538163 4:17051153-17051175 AAGAGGAGGGGGAGGGAGGTGGG + Intergenic
970619296 4:17800831-17800853 AAGTGGAGGTGGGAGGAGGTAGG - Exonic
971150314 4:24024438-24024460 CAGTGAAGGTGGAAGGAGATGGG - Intergenic
971288527 4:25313025-25313047 CACTGGTGAGGGAAAGAGGCGGG - Intronic
971405870 4:26320641-26320663 GAATGGAGGGGTCAGGAGGCGGG - Intronic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
972103139 4:35447468-35447490 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103215 4:35447771-35447793 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103228 4:35447818-35447840 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972698201 4:41468356-41468378 GAGAGGAGGGGGAGGGAGGGAGG - Intronic
972824579 4:42742462-42742484 TACTGGTGGGGGAAGGAGGAAGG + Intergenic
973552974 4:52053452-52053474 GAGTGGAGGGGGAAGAATACAGG - Intronic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
973993734 4:56436211-56436233 CGCTGGGCGGGGAAGGAGGCGGG - Exonic
974235695 4:59179291-59179313 CAGTGGAGGTGGTGGGAGCCAGG + Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975545882 4:75560109-75560131 TTTTGGAGAGGGAAGGAGGCAGG + Intronic
976775133 4:88698804-88698826 CAGTGAGTGGGGAAGAAGGCGGG - Intronic
977165983 4:93697638-93697660 CAGGGGAGGGGGAAAGATGTTGG + Intronic
977577000 4:98685376-98685398 CAGTAGAGTAGGAAGGAGCCGGG - Intergenic
979942552 4:126779903-126779925 CAGTGGAGGGTCAGGGTGGCAGG - Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
981953722 4:150444342-150444364 GAGTGGTGGGGGAGGAAGGCAGG - Intronic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
983707196 4:170676080-170676102 AAGTGGAGGGGGAAGGAATAAGG - Intergenic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
984206389 4:176792508-176792530 CAGTGCCGGGGAAAGGCGGCGGG + Exonic
984490768 4:180431765-180431787 CTGTGGCGGGGGAACGGGGCAGG + Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984911456 4:184676968-184676990 AAGTGAAGGGGGAAAGAGGAAGG - Intronic
985023004 4:185711883-185711905 CAGTGGAGAGGATAGGTGGCGGG - Intronic
985628318 5:1001632-1001654 CCATGGACGGGGCAGGAGGCAGG + Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985776773 5:1848465-1848487 CCCTGGAGGTGGGAGGAGGCTGG + Intergenic
985869920 5:2546049-2546071 AAGTTGAAGGGGAAGCAGGCAGG + Intergenic
986062972 5:4209245-4209267 CAGTGGAGAGGTGAGAAGGCAGG + Intergenic
986062989 5:4209310-4209332 CAGTGGAGAGGTGAGAAGGCAGG + Intergenic
986192416 5:5509635-5509657 GAGTTGAGGGGGAAGAGGGCAGG + Intergenic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
986428412 5:7657260-7657282 CACTGGAGGGCTGAGGAGGCAGG + Intronic
986636479 5:9827154-9827176 GACTGGAGGAGGAAGGAGGAAGG - Intergenic
986679799 5:10222337-10222359 AAGAGGCGGGGGTAGGAGGCAGG + Intergenic
987031260 5:13978962-13978984 CAATGGAGGGCAGAGGAGGCTGG - Intergenic
988415299 5:30939743-30939765 ATGTGGAGTGGGAAGGAGGCAGG - Intergenic
988437279 5:31191149-31191171 GACTGGAGGATGAAGGAGGCAGG + Intergenic
988495554 5:31742543-31742565 CAGTGGTGGGGGAATGGGGTGGG - Intronic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
989536739 5:42572865-42572887 GAGAGGTGGGGGTAGGAGGCAGG + Intronic
990036735 5:51330927-51330949 CTGTGGTGGGGGGAGGAGGGGGG - Intergenic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
990277014 5:54208034-54208056 CAGTGGTGGGGGAAGCAAGGGGG - Intronic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
990444892 5:55885495-55885517 TTGTGCAGGGGGAAGGAGCCTGG - Intronic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
991680524 5:69134895-69134917 GAGGGGAGGGGGAATGAGGCAGG + Intergenic
993905004 5:93612618-93612640 AAGGGGAGAGGGAAGGGGGCGGG + Intergenic
994669980 5:102753911-102753933 CAGTGGACTGGGAAGAAGGTAGG - Intergenic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996003920 5:118398345-118398367 CGGGGGAGGGGGGAGGAGGGAGG - Intergenic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997294798 5:132762656-132762678 CAGGGGAGGGGACAGCAGGCTGG + Intronic
997606773 5:135180479-135180501 CAGTGGAGGATGAAGGAACCAGG - Intronic
997725707 5:136118324-136118346 AAGTGGAGAGGAAAGGGGGCAGG - Intergenic
997871052 5:137505434-137505456 GAGTGGAGGGGGCAGGATGCTGG - Intronic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
998109002 5:139486793-139486815 CCCTGGAGTGGGAAGGAGCCAGG + Intergenic
998140531 5:139697314-139697336 AAGCGGAGAAGGAAGGAGGCCGG + Intergenic
998208373 5:140175434-140175456 CTGGGGAGGGGCAGGGAGGCAGG + Intronic
998460321 5:142305171-142305193 CAGTGGAGGGGGTAGGAGTTGGG - Intergenic
998804706 5:145907045-145907067 CCGTGGAGCAGCAAGGAGGCCGG + Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
998955412 5:147433303-147433325 GGGTGGATGGGGAAAGAGGCAGG + Intronic
999264257 5:150256274-150256296 CGGTGGGTGGGGAAGAAGGCAGG - Intronic
999305250 5:150515447-150515469 CCGTGGAGTGGGGATGAGGCGGG + Intronic
999310291 5:150547387-150547409 CAGGGGAGGGGGTTGGCGGCTGG + Intronic
999353772 5:150904612-150904634 CACTGGTGGGGGAAGTAGGTGGG - Intronic
999719753 5:154390907-154390929 TCCGGGAGGGGGAAGGAGGCTGG + Intronic
1000550634 5:162658459-162658481 CAGTGGAGGGAGCAGGTGGGAGG + Intergenic
1000632191 5:163603250-163603272 CAGTCAAGGGGGAAGGATGCTGG + Intergenic
1000920674 5:167133118-167133140 CAGTAAAGGGGGAAGAAGGGAGG + Intergenic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001143083 5:169161471-169161493 GAGTGGAGGCGGCAGGATGCGGG - Intronic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001404955 5:171469732-171469754 CAAGGGAGGGGGGAGGAGGAGGG - Intergenic
1001417250 5:171554829-171554851 CGGTGAAGTGGGAAGGAGACTGG - Intergenic
1001838486 5:174852927-174852949 CAGTGGAGGGGGATGGCAGTGGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1001959401 5:175871325-175871347 GAATGGAGGGAGAAGGAGACGGG + Intronic
1001981157 5:176037755-176037777 AGATGGAGGGGGAAGGAGGGTGG + Intergenic
1002064755 5:176646515-176646537 AAGTGGAGGTGGAGGGATGCTGG + Exonic
1002065177 5:176648130-176648152 TACTGGAAGGGAAAGGAGGCCGG - Intronic
1002192033 5:177483420-177483442 CACTGGAGGTGAAAGGGGGCTGG + Exonic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002236302 5:177806311-177806333 AGATGGAGGGGGAAGGAGGGTGG - Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002301124 5:178257701-178257723 CCCTGGAGGGGCAAGGAGGGTGG - Intronic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1002662812 5:180802950-180802972 AAGCGGCGGGGAAAGGAGGCGGG - Intronic
1002850908 6:995641-995663 GGATGGAGAGGGAAGGAGGCAGG - Intergenic
1002936971 6:1682353-1682375 CAGTGGAGGCCTGAGGAGGCGGG - Intronic
1002953011 6:1834273-1834295 CAGTGGTGGGGGAAAAATGCTGG + Intronic
1003242024 6:4353295-4353317 CAGTGGAGGAGGATGGCGCCTGG - Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003514831 6:6809288-6809310 CAGTGAAGGGGGAAGAAAGTAGG + Intergenic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004002053 6:11604828-11604850 AGGAGGAGGGGGAAGGAGGAGGG + Intergenic
1004335962 6:14764721-14764743 CAGTGGGGGGGGAATGGGCCTGG - Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005912974 6:30326922-30326944 GAGGGGAGGAGGAAGGAGGGAGG + Exonic
1005953317 6:30647128-30647150 TCGTGAAGGGGAAAGGAGGCCGG - Exonic
1006068027 6:31476609-31476631 CAGTGCAGGGGGCAGGATGGAGG - Intergenic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006388646 6:33746263-33746285 CACGGGAGGGGGCAGGAGGCCGG - Intronic
1006511898 6:34526022-34526044 CCAGGGAGGGGGAAGGAGGAGGG + Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006793482 6:36718137-36718159 CCGGGCAGTGGGAAGGAGGCAGG - Intronic
1007107285 6:39292522-39292544 CAGAGGAGTTGGAATGAGGCGGG - Intergenic
1007181391 6:39931799-39931821 CTGTGGCGGGGGAAGCAGGGAGG - Intronic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007244401 6:40450164-40450186 CAGTGGTGGGGTAAGGAGGCCGG - Intronic
1007322334 6:41036797-41036819 CAGTGAAGCTGGAATGAGGCAGG + Intronic
1007512171 6:42381896-42381918 AAGAGGAGGGGCAAGAAGGCTGG + Intronic
1007686402 6:43669739-43669761 CAGTGTGGGAGGAAGGAGCCTGG - Intronic
1007853485 6:44829256-44829278 GAGTGAAGGGGAAAGGAGGTGGG + Exonic
1007959740 6:45947730-45947752 CCGGGGAGGGGGATGGAGTCTGG + Intronic
1008401780 6:51071708-51071730 CAGTGGAGGAGATAGAAGGCCGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011076279 6:83442761-83442783 CAGTGGAGGTGGAACGAGCAGGG - Intergenic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1011885604 6:92091019-92091041 GAGTGGAGGTGGATGGAGTCAGG - Intergenic
1012791367 6:103701614-103701636 GAGTAGAGGAGGAAGAAGGCGGG - Intergenic
1013817514 6:114116672-114116694 AAGAGGATGGGGAAGGAGGTGGG - Intronic
1013988548 6:116225928-116225950 CTTTGGAGGGGGGTGGAGGCTGG + Intronic
1014348559 6:120309090-120309112 CATTGTGGGGGAAAGGAGGCTGG - Intergenic
1014391516 6:120871724-120871746 AAGTAGAGTGGGAAGGAGGCTGG + Intergenic
1014416402 6:121190242-121190264 AGGTGGAGGGGGAAGGAGGGAGG - Intronic
1015437677 6:133208410-133208432 AATTGGAAGGGGAAAGAGGCAGG - Intergenic
1015445469 6:133299034-133299056 CTGTGGTGGGGGAATGAAGCAGG + Intronic
1015788474 6:136942629-136942651 CAGTGTAGAGGGAAGGAAACAGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016100887 6:140098745-140098767 AAGTGCAGGGGGAAGGGAGCAGG + Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016850816 6:148617101-148617123 CAGGGGAGGGGGATGGAGAAAGG - Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017931912 6:158963406-158963428 AAGGGAAGGGGGAAGGAGGGGGG - Intergenic
1018063182 6:160106227-160106249 GCGTGGAGGAGGAGGGAGGCCGG + Exonic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018209007 6:161462010-161462032 CAATGGTGGGGGAAGATGGCTGG + Intronic
1018226054 6:161629700-161629722 AGGTGGGTGGGGAAGGAGGCAGG - Intronic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1018861222 6:167712252-167712274 TAATGGAGGGGGAATGAGGGTGG + Intergenic
1019278885 7:190542-190564 CAGTGGCGGGGCAGGGAGGGGGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019533576 7:1515933-1515955 GAAGGGAGAGGGAAGGAGGCAGG - Intergenic
1019641635 7:2106549-2106571 CAGGGGTGGGGGGAGAAGGCAGG + Intronic
1019920723 7:4161664-4161686 CCCTGGAGAAGGAAGGAGGCAGG + Intronic
1020077209 7:5266282-5266304 GAGCGGAGGGGGCGGGAGGCAGG + Intergenic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021784245 7:24136516-24136538 CAGTGGGGAGGGGAGGTGGCTGG - Intergenic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1021798726 7:24284061-24284083 GAGTGGCGGGGGGAGGGGGCTGG - Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1021962339 7:25885379-25885401 GAGTGGTGGGGGAAGAAGGGAGG - Intergenic
1022174929 7:27863580-27863602 CAGTGCTGGGGGAAGAAGGATGG - Intronic
1022513011 7:30953406-30953428 AAGTTGAGGGGCAAGGAAGCCGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022974864 7:35547711-35547733 CTGTGGAGAGGGAAGCCGGCAGG + Intergenic
1023156917 7:37260564-37260586 CAGTGGAGGGAGAACTGGGCAGG - Intronic
1023180717 7:37480663-37480685 GAGTGGGGGTGGAAGGAGACTGG + Intergenic
1023293089 7:38687551-38687573 CAGTGGGTGGGTAAGCAGGCAGG + Intergenic
1023822278 7:43986788-43986810 CCGGGGAGGGGGCCGGAGGCTGG + Intergenic
1024076868 7:45825520-45825542 CAGGTGACAGGGAAGGAGGCCGG - Intergenic
1024213781 7:47228956-47228978 GACTGGAGGAGGATGGAGGCAGG - Intergenic
1024331586 7:48160542-48160564 AAGTGCAGGGGGAAGGATGGAGG + Intergenic
1024854333 7:53760129-53760151 CAGTGGATGGGGAATGCAGCAGG + Intergenic
1025127551 7:56355903-56355925 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025602782 7:63015461-63015483 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025871768 7:65440960-65440982 CAGTGCAGGGGGCAGGTGTCTGG - Intergenic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026786672 7:73305974-73305996 CAGTGGAGGAGGCACGGGGCAGG + Intronic
1026827795 7:73595200-73595222 CCGTGGAGGGGCAAGGAGGAGGG - Intronic
1026879631 7:73900440-73900462 GTGGGGAGGGGGAAGCAGGCTGG - Intergenic
1028110265 7:86932326-86932348 GAATGGAGAGGGGAGGAGGCAGG - Intronic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028909829 7:96195557-96195579 CCATGGAGGGGGAGGGAGTCAGG - Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029483222 7:100825053-100825075 CAGTGGAGAGTGGAGGAGGGAGG + Intronic
1029495449 7:100893800-100893822 CAGGGGTGGGGGATGTAGGCCGG + Exonic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029729959 7:102433025-102433047 CAGTGGAGGGGAAAGGAAGGTGG - Intergenic
1029745117 7:102512308-102512330 GAAAGGAGGGGGAAGGAGGAAGG + Intronic
1029750543 7:102540202-102540224 CCGGGGAGGGGGCCGGAGGCTGG + Intronic
1029763109 7:102611469-102611491 GAAAGGAGGGGGAAGGAGGAAGG + Intronic
1029768496 7:102639310-102639332 CCGGGGAGGGGGCCGGAGGCTGG + Intronic
1030319067 7:108145478-108145500 TGGTGGTGGGGGAAGGAGGGGGG + Intergenic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1032055684 7:128682421-128682443 CAGAGGAGGAGGAGGGAGCCTGG - Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032683300 7:134207637-134207659 CAGTGGAGGGGATCGGGGGCTGG + Intronic
1032848662 7:135773522-135773544 CAGAGGAGGAGGGAGGAGCCAGG - Intergenic
1033052015 7:138014247-138014269 TGGTGGAAGGGGAAGCAGGCAGG + Intronic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033544974 7:142391602-142391624 CAGTGGAGGGTGAAGGGGCTGGG + Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034238215 7:149589278-149589300 CACTGGAGGAAGAAGGATGCTGG - Intergenic
1034241313 7:149613274-149613296 CACTGGAGAAGGAAGGATGCTGG - Intergenic
1034271323 7:149804611-149804633 GAGGGGAGGGGGAGAGAGGCAGG + Intergenic
1034274601 7:149818563-149818585 CAGGGGAGGGGGAAGCGGGGAGG - Intergenic
1034549701 7:151812713-151812735 TGGTGGAGGGGAACGGAGGCTGG - Intronic
1034724668 7:153324499-153324521 CCATAGAGGGGGAGGGAGGCAGG - Intergenic
1034859900 7:154586070-154586092 CAGTGGAGGGGCAAGCAGGCAGG + Intronic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1035010781 7:155713536-155713558 CGGTCGATGGGGAAGGAAGCAGG + Intronic
1035302947 7:157909383-157909405 CACTGGGGGGGGGAGGATGCTGG + Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035574331 8:695478-695500 GAGAGGAGAGGGAGGGAGGCGGG - Intronic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1035890941 8:3341836-3341858 TAGTGTAGGGGCAAGGAAGCGGG + Intronic
1035907434 8:3528396-3528418 CACTCGTGGGGGAAGGAGGATGG + Intronic
1036659383 8:10698103-10698125 CAGGGGAGGGGGAGAGATGCAGG + Intronic
1036685676 8:10908411-10908433 CCTGGGAGGGGGAAGCAGGCTGG - Intronic
1037134758 8:15446729-15446751 CAGGAGAGGGGGAGGGAGGGGGG + Intronic
1037584736 8:20268691-20268713 GAGTGGAGGAGGAAGGGGGTGGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037789083 8:21920307-21920329 CGTGGGAGGGGGAAGGAGGCCGG - Intronic
1037819778 8:22130053-22130075 GAGGGGAGAGGGAAGGAGGCGGG + Intronic
1037882073 8:22578423-22578445 CAAGGGAGGGGGCAGGAAGCGGG + Intronic
1038276847 8:26128271-26128293 AGGTGGAGGAGGAAGGAGGGAGG + Intergenic
1038319215 8:26513030-26513052 CAGGGGCGGGGGAACCAGGCGGG + Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039547667 8:38421453-38421475 CAGCGGAGGGGGGAGGCTGCTGG + Intronic
1039680563 8:39730661-39730683 GAGAGGTGGGGGAAGGAGGGAGG + Intergenic
1039938271 8:42066940-42066962 AAGTGGTGGGAGAAGGAGGCAGG + Intergenic
1040305922 8:46211705-46211727 CAATGGCGTGGGAAGGATGCAGG + Intergenic
1040389831 8:46940481-46940503 CAGTGGAGGGTGCTGGGGGCTGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1041059416 8:54021973-54021995 GAGGGGAGGGAGAAGGAGGGAGG + Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1042124734 8:65526904-65526926 CAGTGGAGAGGTAAAGAGGTTGG - Intergenic
1042340140 8:67670275-67670297 AAGGTGAGGGGGAAGCAGGCAGG + Intronic
1042467080 8:69140543-69140565 CGGTGGAGGTGGCAGGGGGCAGG + Intergenic
1042631776 8:70825192-70825214 AAGTGCAGGGGGATAGAGGCAGG - Intergenic
1042794199 8:72642580-72642602 CAGTGGTGGAGGTTGGAGGCAGG + Intronic
1042819543 8:72915426-72915448 CATGGGAGGGGGAAGGAGGTAGG + Intronic
1043627649 8:82283193-82283215 CAGTCGAGGGGGAAGGAGAGGGG + Intergenic
1044531221 8:93309936-93309958 CATGGGAGAAGGAAGGAGGCAGG - Intergenic
1044553687 8:93539139-93539161 TGGTGGAGAGGGGAGGAGGCAGG + Intergenic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1045043171 8:98246815-98246837 CATTGCAGGGGCAAGGAGGGAGG - Intronic
1045105137 8:98885219-98885241 CTGTGCTGGGGCAAGGAGGCAGG - Intronic
1045318994 8:101067380-101067402 TAGGGGAGAGGGCAGGAGGCAGG + Intergenic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045737857 8:105318257-105318279 CGGTGGTGGGGGATGGGGGCAGG - Intronic
1046938467 8:119908089-119908111 AAGTGGAGGCCGAAGGAGTCCGG + Intronic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047769422 8:128018812-128018834 AAGTGGTGGGGGGAGGAGGGAGG - Intergenic
1048181080 8:132194903-132194925 CAGTGGAGGATGTAGCAGGCTGG - Intronic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1048928268 8:139290315-139290337 CAGGTGAGAGGGAAGGAGCCTGG + Intergenic
1049047660 8:140165579-140165601 AAGGGAAGGGGGAAGGAGGGAGG + Intronic
1049298994 8:141859815-141859837 CAGGGGAGAGGAAAGGTGGCTGG - Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049580764 8:143409522-143409544 GAGCGGAGGGGTAGGGAGGCAGG + Intergenic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049663930 8:143834785-143834807 GAGTGGAGTGGGAGAGAGGCAGG + Exonic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1050631274 9:7561222-7561244 CAAAGGAGGGGCAAAGAGGCTGG - Intergenic
1050760601 9:9065387-9065409 CAGTGCATAGGCAAGGAGGCTGG + Intronic
1051305058 9:15700131-15700153 CCATGGAGGGGGTGGGAGGCAGG + Intronic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1051917976 9:22230356-22230378 CAGTGGGGAGGGATGGATGCAGG - Intergenic
1052790829 9:32874137-32874159 CTGGGGAGGGGGAAGGAGAGTGG - Intergenic
1052992185 9:34525231-34525253 CAGGGGAGGGAAATGGAGGCAGG - Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054868563 9:70027630-70027652 CAGTGTAGGGGCAGGGAGGATGG + Intergenic
1054951934 9:70861927-70861949 CAGTGGCGGGGGTGGGGGGCAGG + Intronic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055795971 9:79975258-79975280 GAGTGGCGGGGGCAGGGGGCAGG + Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057314844 9:93961496-93961518 TGGTGGAGGGGGGAGGTGGCAGG - Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057705510 9:97392368-97392390 GGGTGGATGTGGAAGGAGGCGGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057903565 9:98967473-98967495 CAGCTGTGGGGGAAGAAGGCTGG - Intronic
1057952462 9:99380467-99380489 CAGCGGAGGGGAAATGGGGCTGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058139555 9:101342626-101342648 CAGGAGAGGGGGAAGGAGAGAGG + Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1059058821 9:111014018-111014040 GAATGGAGGGAGCAGGAGGCTGG - Intronic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059467957 9:114481293-114481315 CAGTGGAGGGATAACGAGGATGG + Intronic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060201511 9:121654266-121654288 GAGTGGATTGGGAAGGGGGCTGG + Intronic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060803677 9:126561681-126561703 CAGGGGAGGAGACAGGAGGCAGG - Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061367356 9:130178876-130178898 CAGGGGAGGGGAAAGAAGGGAGG - Intronic
1061423308 9:130483886-130483908 AAGTGGAGGAGTAAGGAGGAAGG - Intronic
1061498253 9:130987921-130987943 CAGGGGAGGGGAGCGGAGGCAGG + Intergenic
1061806250 9:133139290-133139312 CTGCGGAGAGGGGAGGAGGCAGG + Intronic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062192669 9:135255876-135255898 CACTGGAGGTGGGAGGAGACAGG - Intergenic
1062194172 9:135263979-135264001 AAGGGGAGGGGGAGGGAGGGTGG - Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062379792 9:136281700-136281722 CCGTGGAGGAGACAGGAGGCAGG + Intronic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062469757 9:136697107-136697129 GATAGGAGGGGGAAGGAGGAGGG - Intergenic
1062586333 9:137251560-137251582 CAGTAGAGGGGACAGGCGGCTGG + Intronic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185756675 X:2659242-2659264 AAGGGGAGGGGGAAGGGGGGAGG - Intergenic
1186174475 X:6910631-6910653 CCCTGGAGGAGGAAGGAGACAGG + Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186287941 X:8065631-8065653 CAGGGGAGGGGAATGGAGGCAGG + Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186476236 X:9859814-9859836 CAGGTGAGGGGGAGGGAGGGAGG - Intronic
1186882018 X:13875857-13875879 CAGAGGTGGGGGAAGGAGATGGG + Intronic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1187131371 X:16506409-16506431 CACTTGAGGGGCAAGGAAGCTGG - Intergenic
1187215012 X:17267662-17267684 TAGAGGAGTGGGAAGGAGGGGGG + Intergenic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188277299 X:28216029-28216051 CGGGGGGGGGGGAAGGAGGGAGG - Intergenic
1189261359 X:39681047-39681069 GCATGGAGGGGGAAGAAGGCTGG - Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1189989495 X:46580721-46580743 GAGTGAACAGGGAAGGAGGCTGG + Intronic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190664836 X:52687193-52687215 CGGTGGAGCGGCACGGAGGCGGG + Intronic
1190674586 X:52771226-52771248 CGGTGGAGCGGCACGGAGGCGGG - Intronic
1190753289 X:53380527-53380549 CAGTGGAGGGGAAAGGAGGTGGG - Intronic
1190874444 X:54449627-54449649 CAGTGCAGGGGAAAGAGGGCGGG + Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190927158 X:54920770-54920792 CTCTGGAGGCGGAAAGAGGCAGG + Intronic
1192363822 X:70455125-70455147 GAGAGGAGGGGGAAGGAGGGAGG - Intronic
1192800666 X:74462055-74462077 CACTGGAGGGAAGAGGAGGCAGG - Intronic
1192839141 X:74836069-74836091 CCATGGTGGGGGAAGGAGGAGGG + Intronic
1192875362 X:75223706-75223728 CACTGCTGGGGGATGGAGGCGGG + Intergenic
1194978309 X:100414868-100414890 CAGTGGCGGGGGAGGCAGGAAGG - Intergenic
1195010631 X:100729854-100729876 CAGGGGAGGGGGAATGAGGGAGG + Intronic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195520317 X:105822304-105822326 CAGTGGACGTGGGAGGGGGCAGG + Intergenic
1195570649 X:106395235-106395257 AAGTGGAGAGGGGAGGAAGCAGG + Intergenic
1195701867 X:107711769-107711791 CTCTGGAGGGCCAAGGAGGCAGG + Intergenic
1195735374 X:108007483-108007505 TACTGGAGGGGAAAGGAGGAAGG + Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196275216 X:113758818-113758840 TAGGGGATGGGAAAGGAGGCTGG - Intergenic
1196480665 X:116143109-116143131 CAATTCAGGGGGTAGGAGGCTGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196556925 X:117099061-117099083 CAGTGGAGAAGGAATTAGGCTGG + Intergenic
1196562966 X:117173028-117173050 TTGTGCAGGGGGAAGGAGCCTGG + Intergenic
1197147434 X:123185179-123185201 TGGTGGATGGGGTAGGAGGCGGG + Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197282409 X:124552727-124552749 CAGAGGAGTGGGAAGGAGATTGG - Intronic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197706778 X:129639898-129639920 GAGTGCAGGGGGATGGAGGAGGG - Intergenic
1198254618 X:134914537-134914559 CTGGGGAGGGGGAAGGATACAGG + Intronic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198790698 X:140342465-140342487 CTGTGGTGGGGGAAGAAAGCAGG + Intergenic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199259168 X:145750636-145750658 TAGTGGCGGGGGGAGGAGGTGGG + Intergenic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1200108337 X:153726351-153726373 CAGTGGAGAGGCAGGAAGGCTGG + Intronic
1200134472 X:153868186-153868208 CAGGAGCGGGGGAAGGAGACAGG - Intronic
1200379997 X:155826106-155826128 TAGTGGAGGGGAAATGAGGATGG + Intergenic
1201187150 Y:11415749-11415771 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1201256346 Y:12111996-12112018 GAGGGAAGGGGGAAGGAGGGAGG - Intergenic
1201300241 Y:12498750-12498772 GGGAGGAGGGGGAAGGAGGAGGG - Intergenic
1201535161 Y:15039189-15039211 AACTGGAGGGGGAAAGAGGGAGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic