ID: 1142071819

View in Genome Browser
Species Human (GRCh38)
Location 16:88094698-88094720
Sequence TCTTGATGGTTCCTAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 142}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142071814_1142071819 7 Left 1142071814 16:88094668-88094690 CCTTCTTGCCGATGCCCTTTTCT 0: 2
1: 0
2: 2
3: 18
4: 172
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071816_1142071819 -7 Left 1142071816 16:88094682-88094704 CCCTTTTCTAGCTTGATCTTGAT No data
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071811_1142071819 16 Left 1142071811 16:88094659-88094681 CCAGACACCCCTTCTTGCCGATG 0: 2
1: 0
2: 1
3: 5
4: 88
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071809_1142071819 26 Left 1142071809 16:88094649-88094671 CCTGACGCCTCCAGACACCCCTT 0: 2
1: 0
2: 2
3: 12
4: 173
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071808_1142071819 27 Left 1142071808 16:88094648-88094670 CCCTGACGCCTCCAGACACCCCT 0: 2
1: 0
2: 1
3: 24
4: 181
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071812_1142071819 9 Left 1142071812 16:88094666-88094688 CCCCTTCTTGCCGATGCCCTTTT 0: 2
1: 0
2: 2
3: 20
4: 171
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071813_1142071819 8 Left 1142071813 16:88094667-88094689 CCCTTCTTGCCGATGCCCTTTTC 0: 2
1: 0
2: 4
3: 19
4: 144
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071815_1142071819 -1 Left 1142071815 16:88094676-88094698 CCGATGCCCTTTTCTAGCTTGAT 0: 2
1: 0
2: 3
3: 14
4: 183
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071810_1142071819 19 Left 1142071810 16:88094656-88094678 CCTCCAGACACCCCTTCTTGCCG 0: 2
1: 0
2: 1
3: 13
4: 145
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142
1142071817_1142071819 -8 Left 1142071817 16:88094683-88094705 CCTTTTCTAGCTTGATCTTGATG 0: 2
1: 0
2: 2
3: 10
4: 176
Right 1142071819 16:88094698-88094720 TCTTGATGGTTCCTAGAGCCTGG 0: 2
1: 0
2: 0
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142071819 Original CRISPR TCTTGATGGTTCCTAGAGCC TGG Intronic