ID: 1142075543

View in Genome Browser
Species Human (GRCh38)
Location 16:88115611-88115633
Sequence CTCTAGTTCTGGAGACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142075537_1142075543 8 Left 1142075537 16:88115580-88115602 CCAGGGCCCTGTGTGTTCCTGGA 0: 2
1: 0
2: 3
3: 48
4: 346
Right 1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG 0: 2
1: 0
2: 1
3: 23
4: 192
1142075538_1142075543 2 Left 1142075538 16:88115586-88115608 CCCTGTGTGTTCCTGGACTTCCT 0: 2
1: 0
2: 3
3: 34
4: 288
Right 1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG 0: 2
1: 0
2: 1
3: 23
4: 192
1142075540_1142075543 -9 Left 1142075540 16:88115597-88115619 CCTGGACTTCCTAACTCTAGTTC 0: 2
1: 0
2: 0
3: 6
4: 151
Right 1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG 0: 2
1: 0
2: 1
3: 23
4: 192
1142075539_1142075543 1 Left 1142075539 16:88115587-88115609 CCTGTGTGTTCCTGGACTTCCTA 0: 2
1: 0
2: 2
3: 20
4: 209
Right 1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG 0: 2
1: 0
2: 1
3: 23
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142075543 Original CRISPR CTCTAGTTCTGGAGACCAGA AGG Intronic
900561374 1:3308752-3308774 CTCCAGTTCTGGGGTCCAGACGG + Intronic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
910484416 1:87696934-87696956 CTCTAGATCAGGAGATCATAAGG + Intergenic
917831579 1:178895580-178895602 CTAGAGTTCAGGAGACAAGAAGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918222116 1:182444604-182444626 CTCTGGTCCTGGGGACCAGTGGG + Intergenic
919160331 1:193821661-193821683 CTCAAATTCTGGAGACCTGGTGG + Intergenic
919927928 1:202202102-202202124 CTTGAGTCCTGAAGACCAGAAGG + Intronic
920390904 1:205600242-205600264 CCCTAGTTCTGGCGAACAGTTGG - Intronic
922182977 1:223250705-223250727 CTCTAGCTCTGGAGGCCTCAAGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1063449411 10:6141449-6141471 CTCCAGGTCTGAAAACCAGAGGG + Intergenic
1063519684 10:6729942-6729964 TTCTAGCTATAGAGACCAGATGG + Intergenic
1065046852 10:21753195-21753217 CTCTACTTCTGGGGACCCCATGG - Intergenic
1065246914 10:23767954-23767976 TTCTACTTCAAGAGACCAGAAGG + Intronic
1065872801 10:29970421-29970443 CTATAGTTGTGGAGATCAAATGG + Intergenic
1067293042 10:44958390-44958412 CTCGAGTTCTGGAGAGCCCAGGG + Intergenic
1067841791 10:49686908-49686930 CTCTGGTTCTTGATTCCAGAGGG - Intronic
1070277604 10:75022480-75022502 CTCTACTCCTGCAGACCAGCAGG - Intronic
1073222720 10:101889568-101889590 CTCTAGTACTCTAAACCAGAGGG - Intronic
1073742260 10:106421095-106421117 TTCTAGTTCTAGATACCTGAGGG + Intergenic
1076383605 10:130041211-130041233 CTCTGGTTCCTGAGTCCAGATGG + Intergenic
1076947390 10:133660547-133660569 TTCTGGTTCTGGAGACACGATGG + Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1078539614 11:12202610-12202632 GTCTTTTTCTGGAGCCCAGACGG - Intronic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1079796725 11:24813156-24813178 CTCTTGTTCAGGAGATCAGATGG - Intronic
1080276905 11:30512975-30512997 CTCTAGTTTGGGACAACAGAGGG + Intronic
1083184525 11:61009456-61009478 CACAAGATCTGGAGACCAAATGG + Intronic
1083266160 11:61547871-61547893 CTCTAGTACTGGAGAACTCAAGG + Intronic
1084590508 11:70087456-70087478 CTCTAGTTCCATAGACCAGGAGG + Intronic
1086594420 11:88554067-88554089 TTACAGTTCTGGAGATCAGAAGG + Intronic
1086774684 11:90815476-90815498 CTATAGTTCTGGAGGCTTGATGG + Intergenic
1088266992 11:107997374-107997396 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1089217578 11:116844102-116844124 CTCTTGTTTTGAAGATCAGAAGG + Intronic
1089730636 11:120516767-120516789 TTCCAGTGCTGGAGACCAGGGGG + Intronic
1092925777 12:13270812-13270834 CTCTGGTACTTAAGACCAGATGG - Intergenic
1098631222 12:72724499-72724521 CACTAGTTCCTGAGTCCAGAGGG - Intergenic
1100548793 12:95627701-95627723 CTCCAGATCAGCAGACCAGATGG - Intergenic
1100786522 12:98084490-98084512 CTCTAGGTCGGAAGTCCAGAGGG + Intergenic
1102655737 12:114480943-114480965 CTCAGGTCCTGGAGTCCAGAAGG - Intergenic
1106284076 13:28303763-28303785 TTGCAGTTCTGGAGGCCAGAAGG - Intronic
1107052409 13:36065599-36065621 CTATAGTTCTAGAGATAAGAGGG - Intronic
1109807102 13:67457439-67457461 TTCTAGTTCTGGATCCTAGAGGG - Intergenic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1112007445 13:95266430-95266452 CTTAAGTTCAGGAGGCCAGAAGG - Intronic
1114602675 14:23969367-23969389 CTCAAGTTCTGGAGACAGGGAGG - Intergenic
1114607043 14:24006496-24006518 CTCAAGTTCTGGAGACAGGGAGG - Intergenic
1118038769 14:61895294-61895316 CTCTAGATTTGGAAGCCAGAGGG - Intergenic
1119654208 14:76405406-76405428 CTTCAGTTCTGGGAACCAGATGG - Intronic
1120194018 14:81463667-81463689 TCATAGTTCTGGAGTCCAGAAGG + Intergenic
1121403482 14:93703289-93703311 TGGAAGTTCTGGAGACCAGAAGG + Intronic
1122174873 14:99909423-99909445 CTCTACTTTTGGACACTAGAAGG + Exonic
1202923464 14_KI270724v1_random:4482-4504 TTCTGGTTCTGGAGACACGATGG - Intergenic
1130760844 15:86818166-86818188 TTATAGCTCTGGAGGCCAGAAGG - Intronic
1130969529 15:88721182-88721204 CTCTGGTTCCTGAGAGCAGAGGG + Intergenic
1131319551 15:91373964-91373986 CTCTATTTCTGGAGGACATAAGG + Intergenic
1131393519 15:92068738-92068760 TTCTAGTTCTGGCCACCAAAGGG - Intronic
1131915283 15:97258269-97258291 CCCTAATTCTGAATACCAGAAGG + Intergenic
1132542124 16:515301-515323 CTCTAACCCTGGAGTCCAGACGG - Intronic
1134372238 16:13636375-13636397 TTACAGTTCTGGAGGCCAGATGG + Intergenic
1135087362 16:19486206-19486228 TTACAGTTCTGGAGGCCAGAAGG + Intronic
1135168037 16:20157620-20157642 CTCTAGTGCTGCAGGCCAAAAGG - Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1138197155 16:55060117-55060139 TTACAGTTCTGGAGGCCAGAAGG - Intergenic
1139289135 16:65841318-65841340 GGCTTATTCTGGAGACCAGAGGG - Intergenic
1141834169 16:86527647-86527669 CGAGAGTTCTGGAGACCAGGCGG - Intergenic
1141985379 16:87576495-87576517 CTCTCACTCTGGAGGCCAGAAGG + Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142186564 16:88697626-88697648 CTGTAGTCCTGGAGACAGGAAGG + Exonic
1142324110 16:89402964-89402986 CTCTAGAGCTGGAGCCCAGGCGG - Intronic
1142552185 17:747617-747639 CTCTAGTTCTGCATGGCAGATGG + Exonic
1146185922 17:30724178-30724200 TCCTAGTTCTGGAGGCCAGAAGG - Intergenic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1148546763 17:48525098-48525120 CTCTTGTTCAGGAGATCAAAGGG + Intergenic
1150646005 17:66977862-66977884 CTCTGGTTCTGGAGACCCTGGGG + Intronic
1151060402 17:71085413-71085435 CTCTAGCTCTGGCAACCACAAGG + Intergenic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1203171291 17_GL000205v2_random:149546-149568 TTCTGGTTCTGGAGACACGATGG + Intergenic
1152999338 18:439472-439494 CTCTGCTTCTGGAGACCATAAGG - Intronic
1153166535 18:2267941-2267963 CTCTATTAGTGGAGATCAGAGGG - Intergenic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1157891709 18:51424243-51424265 CTCTAGAGCTGGAGACAAGGTGG + Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158736772 18:60091311-60091333 CTCTAGATCTTGAGCCCAGAGGG - Intergenic
1159220337 18:65454358-65454380 CTCTGGTTCTGGGATCCAGATGG + Intergenic
1160378568 18:78431649-78431671 CTCTAGGTCTGGAAAGCAGTGGG - Intergenic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1161956723 19:7500214-7500236 CTCTAGGCCTGGAGGCCAGCAGG - Intronic
1162523337 19:11194414-11194436 CTTCAGTTCTGGAGGCCTGAGGG - Intronic
1162972854 19:14191551-14191573 TCCTAGTTCTGGAGGCCAGAAGG + Intronic
1166769172 19:45270530-45270552 CCCTAGATCTGCAGACCACATGG + Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926452209 2:13018930-13018952 CTCTAGATCGGGAGGTCAGAAGG + Intergenic
927269859 2:21194844-21194866 CACCAGCTCTGGAAACCAGAAGG + Intergenic
927359856 2:22220483-22220505 CTACAGTTCTGAAGTCCAGAAGG - Intergenic
927679018 2:25127927-25127949 CCCTAGGGCTGGAGCCCAGATGG + Intronic
931259788 2:60607340-60607362 TCACAGTTCTGGAGACCAGAAGG + Intergenic
931981940 2:67702424-67702446 ATCTAGTTCTGGACTCAAGATGG - Intergenic
933794017 2:85905915-85905937 ATCTAGCCCTGGAGACCAGAAGG - Intergenic
934116198 2:88797107-88797129 CTCTAGTTCAGAAGACCACATGG - Intergenic
934519718 2:95012340-95012362 CTCCAGTCCTGCAGACCAGGTGG + Intergenic
934626959 2:95867734-95867756 CTCTAGTTCAGAAGACCACATGG + Intronic
934806600 2:97233555-97233577 CTCTAGTTCAGAAGACCACATGG - Intronic
934830909 2:97523620-97523642 CTCTAGTTCAGAAGACCACATGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936899868 2:117470492-117470514 CCCTTGGTCTGGAGACCACATGG - Intergenic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
941244954 2:163085227-163085249 TTGTATTTCTGGTGACCAGATGG + Intergenic
941672669 2:168311294-168311316 CTCAAGTTCTGACCACCAGATGG + Intergenic
944127312 2:196309085-196309107 GGCTAATCCTGGAGACCAGAAGG + Intronic
946784591 2:223229429-223229451 CACTAGTTCTGGATATCAGAAGG - Intergenic
947446729 2:230169850-230169872 CCGTAGTCCTGGAGAACAGAGGG - Intronic
948138798 2:235658005-235658027 TCCTAGTTCTGGAGCCTAGAAGG - Intronic
1169132232 20:3172373-3172395 CTCTGGTTCTGGGGACCAAGAGG - Intronic
1170210127 20:13839595-13839617 TCATAGTTCTGGAGGCCAGAAGG + Intergenic
1171815216 20:29780396-29780418 TTCTAGTTCTAGATACCTGAGGG - Intergenic
1172091560 20:32436423-32436445 CTTTAGTTGTGAAGATCAGAAGG + Exonic
1172533109 20:35647591-35647613 CTCTATCACTGGAGTCCAGAAGG - Intronic
1175177849 20:57124144-57124166 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1176125814 20:63474042-63474064 CACTAGCTCTGGAAACCAAAGGG - Intergenic
1176327272 21:5511374-5511396 TTCTGGTTCTGGAGACACGATGG + Intergenic
1176400485 21:6309577-6309599 TTCTGGTTCTGGAGACACGATGG - Intergenic
1176436672 21:6679527-6679549 TTCTGGTTCTGGAGACACGATGG + Intergenic
1176460934 21:7006597-7006619 TTCTGGTTCTGGAGACACGATGG + Intergenic
1176484495 21:7388375-7388397 TTCTGGTTCTGGAGACACGATGG + Intergenic
1177023702 21:15895770-15895792 CTCAAGTTCTGACCACCAGATGG - Intergenic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1178491912 21:33057866-33057888 CTCTTGTTCTGGAAGCCATATGG - Intergenic
1179233835 21:39528065-39528087 CTCTATTTGTGGTCACCAGAAGG - Intergenic
1181381458 22:22508236-22508258 CCCCAGTTCTGGAGACCTGTAGG - Intronic
1181964595 22:26647665-26647687 CTCTCCATCTTGAGACCAGAGGG + Intergenic
1183506758 22:38213817-38213839 CCCTAGGTCTGCAGCCCAGAGGG + Exonic
950750173 3:15122181-15122203 TTGCAGTTCTGGACACCAGATGG - Intergenic
953049450 3:39327609-39327631 CCCCAGTTCTGGAGGCCAGATGG - Intergenic
953201038 3:40778956-40778978 CTTTGGTTCTTTAGACCAGAGGG + Intergenic
956389956 3:68760962-68760984 CTCTACTTTTTGAGACCACAGGG - Intronic
957080062 3:75629869-75629891 TTCTGGTTCTGGAGACACGATGG - Intergenic
957341780 3:78908326-78908348 CACTATATCTGGTGACCAGAGGG + Intronic
957511339 3:81191594-81191616 CCCCAGTTCTGGAGGCCAGAGGG - Intergenic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
964621047 3:158720469-158720491 ATACAGTTCTGGAGGCCAGAAGG + Intronic
967566210 3:190976370-190976392 CTCTAGATCAGGAGATCATAAGG + Intergenic
969320569 4:6409951-6409973 CTCTACTTCCTGAGAGCAGAAGG - Intronic
970138335 4:12951121-12951143 TTGAAGTTCTGGAGGCCAGAAGG + Intergenic
971418441 4:26454367-26454389 TCACAGTTCTGGAGACCAGAAGG - Intergenic
973689923 4:53417112-53417134 CTTTACTTTTGGACACCAGATGG + Intronic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
984398007 4:179225512-179225534 CTCAAGTTCAGGAAACAAGAGGG + Intergenic
984513647 4:180710927-180710949 CTCTATTTCTAGAGCACAGATGG + Intergenic
985450847 4:190061347-190061369 TTCTGGTTCTGGAGACACGATGG + Intergenic
990061685 5:51657982-51658004 GGCTAGTTCTGGAAACCTGAGGG + Intergenic
993004051 5:82412125-82412147 CTCCAGTGATGGAGCCCAGATGG - Intergenic
997727144 5:136131549-136131571 GTCTAGTTCCAGAGACCAAAGGG - Intergenic
1002565325 5:180109879-180109901 ATACACTTCTGGAGACCAGAGGG - Intronic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1005102805 6:22191561-22191583 TCACAGTTCTGGAGACCAGAAGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007302097 6:40875268-40875290 ATCTGGTCCTGGAGACCAGTGGG - Intergenic
1007983688 6:46185965-46185987 ATCTTGTTCTGGAGACAAAAAGG + Intergenic
1013867320 6:114714201-114714223 TTCTATTTCTGGAGTTCAGAGGG - Intergenic
1017638944 6:156471671-156471693 CTCCAGTTCTGGAGTCCATGTGG - Intergenic
1019083372 6:169452010-169452032 CTCCATTTATGGAGACAAGATGG + Intergenic
1022628662 7:32064513-32064535 CTCGAGGCCTGGAGACCAGTTGG - Intronic
1023732352 7:43204602-43204624 CACTAGTTAAGGAGACAAGACGG + Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1026129792 7:67610691-67610713 CATGGGTTCTGGAGACCAGAGGG + Intergenic
1028601818 7:92609017-92609039 CTCTAGTTCCTGGGAGCAGAGGG + Exonic
1031113440 7:117639888-117639910 CTTGATTTCTGGAGACCACAAGG + Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1036536008 8:9653423-9653445 CCACAGTTCTGGAGACCAGGAGG + Intronic
1037021323 8:13975135-13975157 TCACAGTTCTGGAGACCAGACGG - Intergenic
1039730442 8:40269927-40269949 CTGCATTTCTGAAGACCAGATGG - Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1041894010 8:62903311-62903333 CTCTAATTCTGGATTCCTGAAGG + Intronic
1042368023 8:67958798-67958820 CTCTAGTTTTGAAGACTAGATGG + Intronic
1042840495 8:73118607-73118629 TTCTAGCTCTGGAGAGGAGATGG - Intronic
1043861226 8:85319573-85319595 TTCTTGTTTTGGAGACCAGCAGG - Intergenic
1046734378 8:117761385-117761407 TTCTAGTTTTTGAGACCATATGG + Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047184049 8:122616006-122616028 CCCAACTTCTGGAGACAAGAGGG - Intergenic
1048283165 8:133120452-133120474 CTCAAGTTCTGGAAGCCACAAGG + Intronic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1049192624 8:141296974-141296996 CTCAAGTTCTGGAGGCTGGAAGG - Intronic
1049371667 8:142270947-142270969 CTCCAGTCCAGGAGACCGGAAGG - Intronic
1051073542 9:13202856-13202878 CTCTAGTTCTGGTGAACTCAGGG + Intronic
1051133153 9:13885509-13885531 CTGAAATTTTGGAGACCAGAAGG + Intergenic
1051390000 9:16553714-16553736 CTTTAGTTCTAGAGAAGAGATGG - Intronic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052770997 9:32689703-32689725 TTCTAGTTCTAGATACCTGAGGG - Intergenic
1053002225 9:34583537-34583559 CTCAAGCTCTGGACACCAGGTGG + Intronic
1054145875 9:61560315-61560337 TTCTACTTGGGGAGACCAGAAGG - Intergenic
1057415444 9:94858405-94858427 TCACAGTTCTGGAGACCAGAAGG + Intronic
1058651166 9:107176864-107176886 ATACAGTTCTGGAGAGCAGAAGG - Intergenic
1061417667 9:130455943-130455965 CCCGAGTGCTGGAGAGCAGAGGG + Intronic
1061797777 9:133098359-133098381 CTCTGGTTCCAGAGAGCAGAAGG + Exonic
1203434840 Un_GL000195v1:129132-129154 TTCTGGTTCTGGAGACACGATGG - Intergenic
1187514063 X:19949941-19949963 CTCTAGTTCTGAACACCATGTGG - Intronic
1187744024 X:22388737-22388759 TTCCAGTTCTGGAGGCCATAGGG + Intergenic
1189740742 X:44114989-44115011 CTCTAGATCTGAGGCCCAGATGG - Intergenic
1189957860 X:46294521-46294543 CTCTAGTGCAGGAGATCACAGGG + Intergenic
1194090707 X:89579984-89580006 GTCTATTTCTGGAGACCTGGGGG + Intergenic
1195624382 X:106992388-106992410 CTCTAGTTCAGGAAGCCACAGGG + Intronic
1196685853 X:118509729-118509751 TTCCAGTTCTAGAGATCAGAAGG + Intronic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1197747918 X:129945323-129945345 CTCAAGTTCTGAAGTCCAGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200176756 X:154122410-154122432 CTCTAGTTATTCAGAGCAGAAGG - Intergenic
1200443359 Y:3236044-3236066 GTCTATTTCTGGAGACCTGGGGG + Intergenic