ID: 1142075569

View in Genome Browser
Species Human (GRCh38)
Location 16:88115715-88115737
Sequence CCTTCCAGCCGTACTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 5, 2: 2, 3: 9, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142075563_1142075569 7 Left 1142075563 16:88115685-88115707 CCATCTGTACTCCCTCTGGGGGC No data
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075556_1142075569 29 Left 1142075556 16:88115663-88115685 CCTCTGGAGGCTCTGGGCCCTTC 0: 1
1: 1
2: 9
3: 37
4: 295
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075558_1142075569 11 Left 1142075558 16:88115681-88115703 CCTTCCATCTGTACTCCCTCTGG 0: 1
1: 0
2: 7
3: 28
4: 259
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075557_1142075569 12 Left 1142075557 16:88115680-88115702 CCCTTCCATCTGTACTCCCTCTG 0: 1
1: 1
2: 5
3: 34
4: 348
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075567_1142075569 -5 Left 1142075567 16:88115697-88115719 CCTCTGGGGGCTCTGGGTCCTTC 0: 4
1: 3
2: 6
3: 34
4: 321
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075555_1142075569 30 Left 1142075555 16:88115662-88115684 CCCTCTGGAGGCTCTGGGCCCTT 0: 1
1: 1
2: 14
3: 39
4: 293
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118
1142075566_1142075569 -4 Left 1142075566 16:88115696-88115718 CCCTCTGGGGGCTCTGGGTCCTT 0: 4
1: 4
2: 6
3: 38
4: 358
Right 1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 5
2: 2
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142075569 Original CRISPR CCTTCCAGCCGTACTCCTTC TGG Intronic
901803374 1:11722255-11722277 TCTTCCGGCGGTACTCCTTAGGG - Exonic
903325744 1:22567584-22567606 CACTCCAGCCGGCCTCCTTCAGG + Intronic
903460151 1:23515257-23515279 GCTTCCATTTGTACTCCTTCTGG + Intronic
907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG + Intronic
907523060 1:55037841-55037863 CCCTCCTGCCTTCCTCCTTCAGG - Intergenic
908558584 1:65282582-65282604 CCATCCATCCCTCCTCCTTCTGG - Intronic
910426256 1:87122461-87122483 TCTGCCAGGCATACTCCTTCTGG - Intronic
915634551 1:157177102-157177124 CCTCCCAGCCCTGCTCCTGCAGG - Intergenic
915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG + Intergenic
1065494600 10:26315563-26315585 CCTTCTTGCCCTACTCTTTCAGG - Intergenic
1065974258 10:30828851-30828873 CCTTCCAGCACTCCTCATTCTGG - Intronic
1076674173 10:132139778-132139800 CCTTCCAGCAAAACTCCCTCAGG - Intronic
1076890781 10:133282222-133282244 CCTTCCTGGCGAGCTCCTTCCGG + Exonic
1077712738 11:4552648-4552670 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1081318485 11:41660786-41660808 CCTTGCAGCCCTTCTCCTGCAGG - Intergenic
1082749437 11:57000936-57000958 CCTTCCAGCCCTGTTCCTCCAGG - Intergenic
1086561985 11:88178431-88178453 GTTTCCAGCCGTACTCATTTAGG + Intergenic
1088106124 11:106208741-106208763 CCTCCCAGCTGTACTCTTGCTGG - Intergenic
1089122353 11:116146266-116146288 CCTTCCAGCCCTGCTCCTCCAGG + Intergenic
1091344181 11:134841936-134841958 CCTGCCAGCCCAACACCTTCAGG + Intergenic
1091626380 12:2124063-2124085 CCTTCCTGCTGTCCTCCCTCTGG + Intronic
1092945862 12:13453404-13453426 CCTCCCAGCTGGACTCATTCAGG + Intergenic
1095746071 12:45660463-45660485 TCTTCCAGCTGTGCACCTTCTGG + Intergenic
1096399289 12:51291784-51291806 CCTTCCAGCCCTACAGCCTCTGG - Exonic
1098696280 12:73560091-73560113 CCTTCCCTCCGTAACCCTTCTGG - Intergenic
1098758014 12:74389578-74389600 CCCTCCAGCCCCACTCCTCCAGG - Intergenic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1103899391 12:124295468-124295490 CCTCCCGGCCCTGCTCCTTCAGG - Intronic
1103925451 12:124421334-124421356 CCATCGAGCAGTCCTCCTTCAGG - Intronic
1105284971 13:18996174-18996196 CCTTCTAGCTTTAGTCCTTCTGG - Intergenic
1110073561 13:71209823-71209845 CATTACAGCCGTACCCCTTTAGG + Intergenic
1111292497 13:86187048-86187070 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1119262090 14:73243969-73243991 CCTTCCTCCTGTACTCTTTCAGG - Intronic
1121210856 14:92207221-92207243 CCCTCCAGCCAAACTCCCTCAGG - Intergenic
1122957458 14:105077347-105077369 CCTTCCAGCCCTGCTCGTGCTGG + Intergenic
1124141315 15:27079615-27079637 GCTTCCTGCCAGACTCCTTCAGG - Intronic
1128264346 15:66253842-66253864 CCTCCCAGCCTTCCTCCTCCCGG + Intergenic
1129712572 15:77827998-77828020 CCTTCCAACTCTTCTCCTTCAGG + Intergenic
1132387437 15:101410359-101410381 CCTCCCAGCCCTTCTGCTTCAGG - Intronic
1132869300 16:2108602-2108624 CCTCCCAGCGGTACTCAGTCTGG + Exonic
1133381751 16:5336747-5336769 CCCTCCAGCCCCCCTCCTTCTGG + Intergenic
1133966716 16:10537026-10537048 CCTTCCAGCCCTCCACCTCCCGG - Intronic
1134718112 16:16366996-16367018 CCTCCCAGCGGTACTCAGTCTGG - Intergenic
1134956640 16:18385163-18385185 CCTCCCAGCGGTACTCAGTCTGG + Intergenic
1135720600 16:24814358-24814380 CCTTCCAAATTTACTCCTTCTGG + Intronic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271939 16:29153661-29153683 CTTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271949 16:29153695-29153717 CTTTCCAGCCATAGTCCCTCCGG + Intergenic
1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1138607782 16:58099804-58099826 CCTTGCAGCTGTTGTCCTTCTGG - Intergenic
1139516501 16:67455320-67455342 CCCTCCTGCTGTACTCCATCAGG + Intronic
1142075549 16:88115647-88115669 CCGCCGAGCCGTACTCCCTCTGG + Intronic
1142075559 16:88115681-88115703 CCTTCCATCTGTACTCCCTCTGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1143278240 17:5730660-5730682 GCATCCAGCTGCACTCCTTCCGG - Intergenic
1144058340 17:11560310-11560332 CCTTCCAGCCGCACGACTCCAGG - Exonic
1144720171 17:17463581-17463603 CCTTCCAGGGTTACTCCCTCAGG + Intergenic
1145935139 17:28710963-28710985 CCTTCCCACCCTACTCCTTTCGG - Intronic
1146082629 17:29795415-29795437 CTTTCTACCTGTACTCCTTCTGG - Intronic
1149375522 17:56040199-56040221 CCTTCCTGCCTTTCTCCTCCAGG + Intergenic
1151675651 17:75596078-75596100 CCTTCCAGCCTTCCTCCTATAGG - Intergenic
1158169525 18:54581453-54581475 CATTCCTGCCGCACTCCTGCTGG - Intergenic
1159254025 18:65922069-65922091 CCTTCCCTCCCTCCTCCTTCTGG + Intergenic
1159960709 18:74554052-74554074 GATCCCAGCTGTACTCCTTCGGG - Intronic
1162420382 19:10562748-10562770 CCTTCCTCTCGTAGTCCTTCAGG + Exonic
1165127763 19:33612899-33612921 TCTTCCAGCCTTCCTCCTTGAGG + Intergenic
1168639753 19:58023200-58023222 CCTTCACCCCTTACTCCTTCAGG - Intergenic
926325867 2:11784878-11784900 CCTTCCAGCGGAGATCCTTCCGG + Exonic
926741278 2:16112704-16112726 TCTTCCAGCCCTGCTCCTCCAGG - Intergenic
930065509 2:47324607-47324629 CCTGCCAGCTGTCCTCCTTCAGG + Intergenic
933762853 2:85685196-85685218 CCTTCCAGCTGGACTCCCTTAGG - Intronic
938420298 2:131140593-131140615 CCTTTCAGCTGTTCTCCTTCTGG + Intronic
939417849 2:141924253-141924275 ACTCCCAGCTGTACTCCTCCTGG - Intronic
941717610 2:168780181-168780203 CCTTGCAGCCTTTCTCTTTCAGG - Intergenic
942801850 2:179884356-179884378 CTTTCCAGCTGTACCACTTCTGG + Intergenic
943902451 2:193457499-193457521 CCTTCTAGCCGTCTTCCTTGAGG - Intergenic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
948893220 2:240916926-240916948 CCTTCCAGCAGCTCTCCTCCTGG + Intergenic
1169310282 20:4532215-4532237 CCTTCCAGCTGTGCTCCCTCAGG + Intergenic
1169970608 20:11265807-11265829 CGTTCCTGCCTTACTCCTTCAGG - Intergenic
1176546227 21:8201498-8201520 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1176565178 21:8384544-8384566 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG + Intergenic
1178526621 21:33335041-33335063 CCTCCCTGCAGTACTCCTTGTGG - Intronic
1180676013 22:17587128-17587150 CCTTCCAGCCGTCCATCATCAGG + Exonic
1183138173 22:35910548-35910570 CCTTCCATTGGTATTCCTTCTGG - Intronic
1183499063 22:38167578-38167600 CCTTCCAGCTGGACTCGATCAGG - Intronic
1184004793 22:41700001-41700023 CCTTCCCGCCTTCCGCCTTCTGG + Intronic
1203251099 22_KI270733v1_random:117735-117757 CCTTCCACACGTCCTCCCTCAGG - Intergenic
953943488 3:47124308-47124330 CCCTCCAGCTGTACCTCTTCAGG - Exonic
960677456 3:120210044-120210066 CCATCCACCCGTTCTCATTCTGG - Intronic
961087807 3:124084198-124084220 CCTTTCAGGCCTACTCCCTCGGG - Intronic
964743486 3:159990159-159990181 CCTTCCAGGCCTCCTCCTTGTGG + Exonic
966907989 3:184541636-184541658 TCTTCCAGCCTTTTTCCTTCAGG + Intronic
967057373 3:185841350-185841372 CCTTCCTGCCCTACTGTTTCTGG - Intergenic
967916532 3:194582616-194582638 CCTTCCGGCCTTCCTCCTACAGG - Intergenic
973864068 4:55094297-55094319 CCTTCCAACCATACTTCCTCAGG - Intronic
975983388 4:80183540-80183562 CCCTCCAGCCATTCTCCCTCCGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
991198638 5:63962868-63962890 CAGTCCAGCCTTACTCCCTCAGG + Intergenic
992151617 5:73909864-73909886 CCTGCCCGCGGTGCTCCTTCCGG + Exonic
997302098 5:132813687-132813709 CCTTCCCGCCGTGCTCCTGCAGG - Exonic
998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG + Intergenic
998850111 5:146344059-146344081 CCTTCCAGCCGAATCCCCTCTGG + Intergenic
1002774389 6:316251-316273 CCTGCCAGCCATAGCCCTTCAGG + Intronic
1006059022 6:31405306-31405328 CCCTCCAGCATTACTCCTTTTGG + Intronic
1006071507 6:31500191-31500213 CCCTCCAGCATTACTCCTTTTGG + Intronic
1011660767 6:89592149-89592171 CCCTCCAGCCATAGCCCTTCTGG + Intronic
1012500318 6:99881164-99881186 CCTCCCAGCCCTGATCCTTCAGG - Intergenic
1013340698 6:109212733-109212755 TCTTCCAGCTCTTCTCCTTCTGG + Intergenic
1013586332 6:111582256-111582278 CCTTCCAGTCATGCTTCTTCTGG + Intronic
1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG + Intronic
1017010098 6:150057750-150057772 CCTTCCAGCTGGGGTCCTTCGGG + Intergenic
1019610873 7:1936071-1936093 ACTCCCAGCCCTGCTCCTTCAGG + Intronic
1025242125 7:57285843-57285865 CCTTCCAGTCCAAATCCTTCCGG + Intergenic
1031631309 7:124046561-124046583 CCATCCACCCATATTCCTTCTGG + Intergenic
1032757569 7:134905651-134905673 CCCTCCAGCCCTGCTCCTCCAGG - Intronic
1033801713 7:144909398-144909420 CCCTGCAGCCTTTCTCCTTCAGG + Intergenic
1036398394 8:8387024-8387046 ACTTCCAGCCCTGCTCCCTCCGG - Intergenic
1039468196 8:37798056-37798078 GCTTCCAGCCGGTCTCCTTAGGG + Intronic
1039659863 8:39449906-39449928 CCCTCCAGCCCTGCTCCTCCAGG + Intergenic
1051501405 9:17781842-17781864 CTTCCCAGCCTTACTCTTTCAGG + Intronic
1056787946 9:89605971-89605993 CCTTCCAGGCGTCCTCGTTGGGG - Exonic
1056845218 9:90031786-90031808 CCTTCCAGCCTGAATGCTTCTGG + Intergenic
1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG + Intergenic
1203467504 Un_GL000220v1:101002-101024 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1186263327 X:7804611-7804633 CCTTCCAGCCTTTCACCTTGGGG - Intergenic
1190747368 X:53332499-53332521 CCTTCCAGCTTTCCTCCTCCTGG - Intergenic
1193883801 X:86960321-86960343 CCCACCAGCCCTGCTCCTTCTGG - Intergenic
1198472567 X:136961925-136961947 TCTTCCAGCCAAACTCCTGCTGG - Intergenic