ID: 1142075579

View in Genome Browser
Species Human (GRCh38)
Location 16:88115749-88115771
Sequence CCTTCCAGCCATACTCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 5, 2: 7, 3: 21, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142075573_1142075579 7 Left 1142075573 16:88115719-88115741 CCAGCCGTACTCCTTCTGGGGGC No data
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216
1142075567_1142075579 29 Left 1142075567 16:88115697-88115719 CCTCTGGGGGCTCTGGGTCCTTC 0: 4
1: 3
2: 6
3: 34
4: 321
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216
1142075577_1142075579 -4 Left 1142075577 16:88115730-88115752 CCTTCTGGGGGCTCTGGGTCCTT No data
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216
1142075568_1142075579 11 Left 1142075568 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG 0: 1
1: 4
2: 1
3: 17
4: 127
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216
1142075566_1142075579 30 Left 1142075566 16:88115696-88115718 CCCTCTGGGGGCTCTGGGTCCTT 0: 4
1: 4
2: 6
3: 38
4: 358
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216
1142075574_1142075579 3 Left 1142075574 16:88115723-88115745 CCGTACTCCTTCTGGGGGCTCTG 0: 1
1: 8
2: 8
3: 49
4: 390
Right 1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG 0: 1
1: 5
2: 7
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142075579 Original CRISPR CCTTCCAGCCATACTCCCTC CGG Intronic
901295553 1:8158436-8158458 CCTTCCAGAGATCCTCACTCTGG + Intergenic
902489007 1:16766890-16766912 CCTTCCTGCCCTCCTCCCTGAGG + Intronic
902562703 1:17287677-17287699 CTTTCCAGCCATCCTCACCCAGG - Intergenic
903685811 1:25131090-25131112 CCTTCCAGCCTTACGCTCCCTGG - Intergenic
904935694 1:34128131-34128153 CCTTCCTCCCACATTCCCTCTGG + Intronic
905147275 1:35896747-35896769 CCCTTCAGCCTAACTCCCTCAGG - Intronic
905253313 1:36664181-36664203 CCTTCCAGCCACCCTCCCCATGG - Intergenic
905627009 1:39495750-39495772 CCTGCCATCCTTCCTCCCTCAGG - Intronic
905669927 1:39785021-39785043 CCTGCCATCCTTCCTCCCTCAGG + Intronic
906689724 1:47784667-47784689 CCCTCCTGTCATACTTCCTCAGG - Intronic
910426256 1:87122461-87122483 TCTGCCAGGCATACTCCTTCTGG - Intronic
910456101 1:87398990-87399012 CCTTCCAGCCATTTGCTCTCAGG - Intergenic
912382417 1:109254661-109254683 CCTTCAGGCCACACTCCCTGGGG - Intronic
912853559 1:113147578-113147600 CCTCCCAGCCACACACACTCTGG + Intergenic
913545447 1:119863495-119863517 CTCTCCAGCGAGACTCCCTCTGG - Intergenic
914724438 1:150315914-150315936 CCTTCCTCCCTTCCTCCCTCTGG + Intergenic
915593693 1:156884533-156884555 CCTTCCTGCCCTGCTCCCACAGG + Intergenic
915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG + Intergenic
917028905 1:170668609-170668631 TCTACCAGCCACACTCTCTCGGG + Intronic
917103443 1:171468819-171468841 GCTTCAAGCAATTCTCCCTCAGG - Intergenic
917504424 1:175615049-175615071 CCTTCCTTCCTTCCTCCCTCAGG - Intronic
919529850 1:198703439-198703461 CCTTCCACCCACTCTACCTCGGG + Intronic
923531429 1:234815634-234815656 CCTTCCTGCCCTCCTCCCTGAGG - Intergenic
923566312 1:235079329-235079351 CCTTCCCCACATACTCCCTGTGG + Intergenic
1066432804 10:35368864-35368886 CCTCCCAGCCTCACTTCCTCTGG - Intronic
1067063843 10:43092673-43092695 GCTGCCAGCCAGACTCACTCGGG - Intronic
1067201361 10:44174835-44174857 CCCTTCAGCCATACTGCCACTGG - Intergenic
1067559352 10:47294080-47294102 CATCCCAATCATACTCCCTCAGG + Intergenic
1070903342 10:80050042-80050064 CCTGCCAACCATAATCCCTAGGG + Intergenic
1072526542 10:96276663-96276685 CCTCCCAGCCTTTTTCCCTCTGG - Intergenic
1072653015 10:97310234-97310256 GGTTCCAGCCATTCTCCCACAGG - Intergenic
1073326742 10:102647644-102647666 CCTTTAAGGCAGACTCCCTCCGG - Intronic
1074225227 10:111478287-111478309 CCCTCCTGCCATTTTCCCTCAGG + Intergenic
1074691764 10:116012199-116012221 CCTTCCACCCATCCTCACCCAGG + Intergenic
1075632706 10:124010841-124010863 CCTCCCAGCCCTCCTCCCTATGG - Intronic
1075801102 10:125153789-125153811 CCTTCCAGAGAAACTTCCTCAGG + Intronic
1076674173 10:132139778-132139800 CCTTCCAGCAAAACTCCCTCAGG - Intronic
1076706264 10:132303259-132303281 CCGTCAAGCGATACTCCCTACGG + Intronic
1080606855 11:33870596-33870618 CCTCCCAGCCACCCTCCCTCTGG - Intronic
1082258392 11:50057871-50057893 CCTTCCACTTTTACTCCCTCAGG + Intergenic
1084008895 11:66336951-66336973 CCTCACAGCCAGACTCCCCCTGG - Intergenic
1084593648 11:70104767-70104789 GCTTCCATCCAAAGTCCCTCTGG - Intronic
1085707547 11:78800307-78800329 CCTTCAAGCCATCTTCCCTAGGG - Intronic
1087457230 11:98402656-98402678 CCTTCCCCTCACACTCCCTCAGG + Intergenic
1088216881 11:107520343-107520365 CCTTCCAAATATATTCCCTCTGG + Intronic
1089122353 11:116146266-116146288 CCTTCCAGCCCTGCTCCTCCAGG + Intergenic
1090252093 11:125258770-125258792 CCTGCCAGTCATCCACCCTCTGG - Intronic
1091626380 12:2124063-2124085 CCTTCCTGCTGTCCTCCCTCTGG + Intronic
1091847835 12:3670923-3670945 CCTGCCAGCCATGCTTGCTCTGG - Intronic
1092092458 12:5814006-5814028 CCTTCCAGATATACTCTCTACGG + Intronic
1094131937 12:27083911-27083933 TCTTCCAGCCCTACTTACTCTGG - Intergenic
1096399289 12:51291784-51291806 CCTTCCAGCCCTACAGCCTCTGG - Exonic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1102101245 12:110280895-110280917 CCTTCCAACCATCCGCCCACCGG + Intronic
1102869843 12:116405341-116405363 CCTGCCAGCCTCACTTCCTCTGG - Intergenic
1103572897 12:121856799-121856821 GCTTTCAGCCAGACCCCCTCTGG + Intronic
1103874043 12:124113672-124113694 CCTTTCAGCCATCCTCCCAAAGG + Intronic
1104133668 12:125917745-125917767 GCTTCCACCCCTCCTCCCTCAGG - Intergenic
1106764237 13:32897850-32897872 TCTTCCAGCCTTACTCTCTGGGG + Intergenic
1107320093 13:39177424-39177446 CCTTCTTCCCCTACTCCCTCAGG - Intergenic
1108071427 13:46633215-46633237 CCTTCCAGAAATACTTCCTTGGG - Intronic
1113708427 13:112448629-112448651 CCTTCCTTCCATTCTCCCTGTGG - Intergenic
1119265407 14:73261067-73261089 CCTTCCTGCCATCCTCCCCGTGG + Intronic
1119442505 14:74637727-74637749 CCATCCTGCCATCCTCCCCCAGG + Intergenic
1119656291 14:76419627-76419649 CCTCCCCGCCATCCTCACTCTGG - Intronic
1121210856 14:92207221-92207243 CCCTCCAGCCAAACTCCCTCAGG - Intergenic
1121774516 14:96582028-96582050 CCTACCAGCCACGCCCCCTCTGG + Intergenic
1124141315 15:27079615-27079637 GCTTCCTGCCAGACTCCTTCAGG - Intronic
1124504021 15:30256445-30256467 CCTTCCTGCCACACTGCCCCTGG + Intergenic
1124618258 15:31258049-31258071 CCATCCACCCATAGTCCCTGTGG - Intergenic
1124739532 15:32282201-32282223 CCTTCCTGCCACACTGCCCCTGG - Intergenic
1124877482 15:33608899-33608921 TCTCCCAGCCATATTTCCTCTGG + Intronic
1126405468 15:48318294-48318316 CTTTCCCGCCCTTCTCCCTCTGG + Intergenic
1126946720 15:53829720-53829742 CCTTCCAGTCAGAATGCCTCAGG - Intergenic
1133814089 16:9183214-9183236 CATTCCTGCCCGACTCCCTCTGG - Intergenic
1136269711 16:29141509-29141531 GCTTCCAGCCACCCGCCCTCGGG + Intergenic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271939 16:29153661-29153683 CTTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271949 16:29153695-29153717 CTTTCCAGCCATAGTCCCTCCGG + Intergenic
1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1137769935 16:51008144-51008166 CCTTCCATCCAAGCTGCCTCTGG + Intergenic
1141159796 16:81621659-81621681 CATTCCAGCCATACCCGCTGTGG - Intronic
1141437074 16:84005980-84006002 CCTTCCAGCCAGATGTCCTCAGG - Intergenic
1142073335 16:88103439-88103461 GCTTCCAGCCACCCGCCCTCGGG + Intronic
1142075549 16:88115647-88115669 CCGCCGAGCCGTACTCCCTCTGG + Intronic
1142075559 16:88115681-88115703 CCTTCCATCTGTACTCCCTCTGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1142117705 16:88368619-88368641 CCTCCCAGCCACACCCTCTCAGG - Intergenic
1142509552 17:385504-385526 CCTTCCAGCCTGAGTCCCGCGGG - Intronic
1142664774 17:1456281-1456303 CCTTCCCGGCAGCCTCCCTCGGG - Intronic
1142880089 17:2877338-2877360 CCTTTCAGCCAGCCTCCCTGCGG + Intronic
1143262286 17:5608419-5608441 ACTTCCAGCCAGAGGCCCTCAGG + Intronic
1143514623 17:7413617-7413639 CCTTCCCGCCATACCCCCTGAGG - Intronic
1143565926 17:7720527-7720549 CCTTCCAACCTTACTGGCTCCGG - Intronic
1144720171 17:17463581-17463603 CCTTCCAGGGTTACTCCCTCAGG + Intergenic
1145259249 17:21344988-21345010 CCTCCCAGCCCTCCACCCTCAGG - Intergenic
1146530948 17:33607319-33607341 CCTCCCTGCCTTACACCCTCAGG - Intronic
1147322854 17:39656600-39656622 CTTCCCAGCCATAATCCATCTGG - Intronic
1148749031 17:49934311-49934333 TCCTCCAGCCACACTTCCTCTGG + Intergenic
1149665900 17:58364611-58364633 CCCTCCAGCCTTCCTCCCTAGGG + Intronic
1152442433 17:80317217-80317239 CCTTCCAGCCATGCTCCGCGGGG - Exonic
1152670283 17:81600045-81600067 CCTTCCAGCCACACTTCATGAGG - Intronic
1155356860 18:24961438-24961460 CCTTCCAGGGATTCTCCCTAAGG + Intergenic
1163939520 19:20479176-20479198 TCTCCCATCCATACTCACTCAGG - Intergenic
1165545619 19:36532923-36532945 TCTTCCAGACATACTTCCTATGG - Intergenic
1166071843 19:40392646-40392668 CCTTCCAGCCAGCCCTCCTCAGG - Intergenic
1166735609 19:45082429-45082451 CATTCCAGCCCTACTCACTTTGG + Intronic
1168135578 19:54349181-54349203 CCATCCATCCATCCACCCTCAGG - Intergenic
1168135587 19:54349215-54349237 CCCTCCATCCATCCACCCTCAGG - Intergenic
925125196 2:1449447-1449469 CATTCCAGCAAAACTCCATCAGG - Intronic
925340287 2:3131208-3131230 CCTTCCAGCTCTCCTCCCCCAGG - Intergenic
928118223 2:28563362-28563384 CCTGTCACCCACACTCCCTCTGG - Intronic
931731360 2:65156188-65156210 CATTCCAGCTCTCCTCCCTCAGG + Intergenic
932194135 2:69768387-69768409 GCTTCCAGTCATCCTCTCTCTGG - Intronic
932489917 2:72114098-72114120 CCTGCCAGCCATCCTCCCAGGGG - Intergenic
932862143 2:75305244-75305266 TCTTCCAGCCACTGTCCCTCTGG - Intergenic
933727404 2:85434703-85434725 CCTGCAGGCCAGACTCCCTCAGG + Intronic
933762853 2:85685196-85685218 CCTTCCAGCTGGACTCCCTTAGG - Intronic
935656281 2:105426476-105426498 CCTTCCAGACATCCTGCCTAGGG + Intronic
936067739 2:109344806-109344828 CCCTCCAGCCCTACCTCCTCTGG - Intronic
936071382 2:109374056-109374078 CCTTAAAGCCCTCCTCCCTCAGG + Intronic
939295841 2:140263255-140263277 TCTTCCAGCCAAACTGCATCTGG + Intronic
939981535 2:148788141-148788163 CGTTTCTGCCATACTACCTCTGG + Intergenic
942442412 2:176050082-176050104 CCTTCCAGCCATCCACGCACAGG + Intergenic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
947952928 2:234163556-234163578 CCCTCCAGCAATACTCAATCTGG - Intergenic
948037723 2:234872840-234872862 CCTTCCAGCCACACCTCCTCAGG - Intergenic
948565539 2:238884048-238884070 TCTTCCAGCCTTCCTCCCTTCGG + Intronic
949002957 2:241627941-241627963 CTTTGGAGCCACACTCCCTCTGG + Intronic
1169310282 20:4532215-4532237 CCTTCCAGCTGTGCTCCCTCAGG + Intergenic
1169970608 20:11265807-11265829 CGTTCCTGCCTTACTCCTTCAGG - Intergenic
1171333401 20:24361048-24361070 CCTCCCAGGCATTGTCCCTCTGG - Intergenic
1171767653 20:29298973-29298995 CTTTGCAACCATACTCCCCCCGG + Intergenic
1174062227 20:47840769-47840791 CCTTCCACCCATCTTTCCTCGGG - Intergenic
1174150667 20:48483977-48483999 CCTTCCACCCATCTTTCCTCAGG - Intergenic
1176546227 21:8201498-8201520 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1176548227 21:8210792-8210814 CTTTGCAACCATACTCCCCCCGG - Intergenic
1176556120 21:8255000-8255022 CTTTGCAACCATACTCCCCCCGG - Intergenic
1176565178 21:8384544-8384566 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1176567158 21:8393827-8393849 CTTTGCAACCATACTCCCCCCGG - Intergenic
1176575057 21:8438037-8438059 CTTTGCAACCATACTCCCCCCGG - Intergenic
1178124811 21:29504994-29505016 CATTACAGCCATTCTCTCTCTGG - Intronic
1178553961 21:33569735-33569757 CACTCCAGCCATCCTCCCTCAGG - Intronic
1180342751 22:11630713-11630735 CTTTGCAACCATACTCCCCCCGG - Intergenic
1180766117 22:18346656-18346678 CCTTCCGGACCCACTCCCTCTGG - Intergenic
1180780196 22:18515722-18515744 CCTTCCGGACCCACTCCCTCTGG + Intergenic
1180812912 22:18773043-18773065 CCTTCCGGACCCACTCCCTCTGG + Intergenic
1180911936 22:19456717-19456739 CCTTCCAGCCATGCTTCCGGGGG - Intronic
1181199090 22:21207359-21207381 CCTTCCGGACCCACTCCCTCTGG + Intergenic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1203227735 22_KI270731v1_random:87547-87569 CCTTCCGGACCCACTCCCTCTGG - Intergenic
1203251099 22_KI270733v1_random:117735-117757 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1203253106 22_KI270733v1_random:127092-127114 CTTTGCAACCATACTCCCCCCGG - Intergenic
1203261161 22_KI270733v1_random:172173-172195 CTTTGCAACCATACTCCCCCCGG - Intergenic
953759198 3:45673515-45673537 CCTTCCAGACATGCTCCCAGGGG + Intronic
953970582 3:47343994-47344016 CCTTCCAGGAACAGTCCCTCAGG + Exonic
954413719 3:50382721-50382743 CCTGCCAGGCAGACTCTCTCAGG - Intronic
954704368 3:52471339-52471361 CCTCCCAGCCATGTGCCCTCAGG - Intronic
956018525 3:64909707-64909729 CTTTCCATCCATACTGACTCTGG - Intergenic
956674102 3:71718770-71718792 ACTTCCAGCCTTTCTACCTCAGG - Intronic
959590896 3:108079517-108079539 AGTCCCAGCCATGCTCCCTCTGG - Intronic
961087807 3:124084198-124084220 CCTTTCAGGCCTACTCCCTCGGG - Intronic
961713586 3:128844761-128844783 CCTTGCTGCCATCCACCCTCGGG - Intergenic
962795017 3:138842468-138842490 CCTTCCTGACTTCCTCCCTCCGG + Intergenic
965955403 3:174362940-174362962 CCTTCCAGCCAAAGACCATCAGG + Intergenic
968691552 4:1992767-1992789 CCTTCGAGCCAACTTCCCTCAGG - Intronic
969431954 4:7160539-7160561 GGTTCCAGCCAGCCTCCCTCTGG - Intergenic
969517417 4:7655346-7655368 CCTTCCAGCCCTGAGCCCTCGGG - Intronic
973051934 4:45608528-45608550 TCTCCCACCCATACTCGCTCAGG + Intergenic
973761258 4:54117710-54117732 GCTTCCAGCCATACTCAATAGGG - Intronic
973864068 4:55094297-55094319 CCTTCCAACCATACTTCCTCAGG - Intronic
975983388 4:80183540-80183562 CCCTCCAGCCATTCTCCCTCCGG - Intergenic
976407025 4:84671576-84671598 CCTTCCAGCTTTAATCCCCCTGG + Exonic
979424101 4:120543929-120543951 CCTTCCATCCATACACTCTCAGG + Intergenic
985841841 5:2312198-2312220 ACTTCCAGCCACACTGCCTGTGG - Intergenic
985999822 5:3621496-3621518 CCTTCCAGCCTTCCAGCCTCAGG - Intergenic
986536532 5:8793777-8793799 CCTTCCCTTCATACTCCATCAGG + Intergenic
987171714 5:15266413-15266435 CATTCCAAACATACTCCATCAGG - Intergenic
991198638 5:63962868-63962890 CAGTCCAGCCTTACTCCCTCAGG + Intergenic
993032652 5:82723213-82723235 CCTTCCCCACATCCTCCCTCAGG - Intergenic
995778101 5:115746736-115746758 CCATCCCTCCATGCTCCCTCTGG - Intergenic
996430569 5:123371610-123371632 CCTTCAGGCCATCCTCCCTGTGG - Intronic
998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG + Intergenic
998850111 5:146344059-146344081 CCTTCCAGCCGAATCCCCTCTGG + Intergenic
999734489 5:154502641-154502663 CCTTCCAGGCTCACTGCCTCAGG - Intergenic
1000143819 5:158433185-158433207 CCCTCCAGCCATTCTCCCTTAGG - Intergenic
1001221517 5:169904509-169904531 CCTTCCCACCTCACTCCCTCAGG - Intronic
1002417930 5:179130431-179130453 CCTCCCAGCCATCCTGCCCCGGG - Intronic
1002774389 6:316251-316273 CCTGCCAGCCATAGCCCTTCAGG + Intronic
1003030560 6:2597078-2597100 CCTTCCTGCCAACCTGCCTCTGG + Intergenic
1003042424 6:2700461-2700483 CTTACCAGCCAGGCTCCCTCTGG + Intronic
1003347623 6:5285302-5285324 CCTTCCTCCCCTTCTCCCTCTGG - Intronic
1004148601 6:13092885-13092907 CTTTCCTGCCAGAATCCCTCAGG - Intronic
1005502879 6:26445364-26445386 CCTTCCTGCAAGATTCCCTCAGG + Intronic
1006920585 6:37624921-37624943 CCTTGCAGCCATCCTCCCTGGGG + Intergenic
1006990106 6:38208084-38208106 CCTTCCAGCCCTGCTCCCAAAGG - Intronic
1007777694 6:44233002-44233024 CCTGCCAGCCCTACTCACTTGGG - Exonic
1011660767 6:89592149-89592171 CCCTCCAGCCATAGCCCTTCTGG + Intronic
1013586332 6:111582256-111582278 CCTTCCAGTCATGCTTCTTCTGG + Intronic
1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG + Intronic
1016428647 6:143959988-143960010 CAATCCAGCCATACTTCCTGAGG - Intronic
1018458092 6:163971033-163971055 CCTTCCAGACACCCTCCCCCTGG + Intergenic
1019544152 7:1565159-1565181 GCTTCCACCCAACCTCCCTCGGG - Intergenic
1022220559 7:28309633-28309655 CCTACCAGCCCTAACCCCTCAGG + Intronic
1022517307 7:30984162-30984184 CCTTCCAGCCAGCCTCCCCGCGG + Intronic
1023497014 7:40808464-40808486 ACTTCCAGCCATGCTCCCTGGGG + Intronic
1023981572 7:45073618-45073640 CCTTCCCCCCATCCTCCCTGGGG - Intronic
1024055570 7:45658030-45658052 CCTGCCAACCAGACTCCCTGTGG + Intronic
1024582350 7:50810173-50810195 CCTTCCAGACATTTTCCCCCGGG + Intergenic
1024895869 7:54261320-54261342 CCTCCCAGCCATGCTTCCTGTGG - Intergenic
1025605755 7:63038865-63038887 CCTTCCAGCCTTTGTCTCTCTGG - Intergenic
1027504282 7:78996111-78996133 CCCACCAACCATTCTCCCTCTGG + Intronic
1029803613 7:102975091-102975113 TCTCCCACCCATACTCGCTCAGG + Intronic
1031631309 7:124046561-124046583 CCATCCACCCATATTCCTTCTGG + Intergenic
1034972451 7:155427688-155427710 CCCCCCAGCCACACTCCCTACGG + Intergenic
1035257955 7:157643964-157643986 TCTTCCAGCCACAGTCCCACGGG - Intronic
1036398394 8:8387024-8387046 ACTTCCAGCCCTGCTCCCTCCGG - Intergenic
1036897253 8:12646146-12646168 CCTCCAAGCCATACAGCCTCAGG + Intergenic
1037281228 8:17244881-17244903 CCCTCCAGCCAAAATCCATCAGG - Intronic
1047322364 8:123799253-123799275 CCTTCCAGCCATATCACCTCAGG - Intronic
1048335725 8:133500751-133500773 CCTCTCAGCCATGCTCCCTGAGG + Intronic
1048963700 8:139600066-139600088 CCCTCCAGCCAGCCTGCCTCAGG + Intergenic
1049574083 8:143382483-143382505 TCTTGCAACCATGCTCCCTCTGG - Exonic
1054990698 9:71322482-71322504 TCATCCAGTCATACTGCCTCAGG + Intronic
1057714472 9:97480056-97480078 TCTTCCTGCCTTCCTCCCTCAGG - Intronic
1057914953 9:99048226-99048248 CCTTTCTCCCCTACTCCCTCTGG - Intronic
1059633519 9:116150730-116150752 CCTTCCAGCCCTCCTCCCCAGGG - Intergenic
1060292648 9:122318556-122318578 CCTACCAGCCATCCTTCCTGAGG - Intronic
1061947348 9:133916145-133916167 CCTTCCCTCCATTCTCCCTGGGG - Intronic
1062128277 9:134878277-134878299 GCTTCCAGCCCTAGTTCCTCGGG - Intergenic
1203467504 Un_GL000220v1:101002-101024 CCTTCCACACGTCCTCCCTCAGG - Intergenic
1203469508 Un_GL000220v1:110239-110261 CTTTGCAACCATACTCCCCCCGG - Intergenic
1203477329 Un_GL000220v1:154211-154233 CTTTGCAACCATACTCCCCCCGG - Intergenic
1203361003 Un_KI270442v1:219133-219155 CTTTGCAACCATACTCCCCCCGG + Intergenic
1192208274 X:69110309-69110331 CCATCCACACATACTGCCTCAGG + Intergenic
1192731523 X:73806380-73806402 CCTTCCAGACCTCCTCCCCCAGG - Intergenic
1193825953 X:86227452-86227474 TCTTTCAGCCATACTCTCTATGG + Intronic
1194205777 X:91009567-91009589 CCTTCCAGACATACTGGGTCAGG + Intergenic
1195364913 X:104116384-104116406 CCTCCCAGGCAAACTCCCTCAGG - Intronic
1196900339 X:120376279-120376301 CCTCCCAGTCATGCTTCCTCAGG - Intronic
1197378073 X:125706455-125706477 TCTTCCACCCATACTACCTTAGG + Intergenic
1198472567 X:136961925-136961947 TCTTCCAGCCAAACTCCTGCTGG - Intergenic
1200232198 X:154449659-154449681 CCCTCCTGCCTTCCTCCCTCAGG + Exonic
1200551535 Y:4584378-4584400 CCTTCCAGACATACTGGGTCAGG + Intergenic
1201057101 Y:10005507-10005529 CTTTCCAGACATGCTCCCCCTGG - Intergenic