ID: 1142079011

View in Genome Browser
Species Human (GRCh38)
Location 16:88138009-88138031
Sequence TGGTGGAATGCTCCGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142079011_1142079015 -9 Left 1142079011 16:88138009-88138031 CCCCATCACGGAGCATTCCACCA No data
Right 1142079015 16:88138023-88138045 ATTCCACCACTCCCGGTCCAAGG No data
1142079011_1142079016 -8 Left 1142079011 16:88138009-88138031 CCCCATCACGGAGCATTCCACCA No data
Right 1142079016 16:88138024-88138046 TTCCACCACTCCCGGTCCAAGGG No data
1142079011_1142079024 24 Left 1142079011 16:88138009-88138031 CCCCATCACGGAGCATTCCACCA No data
Right 1142079024 16:88138056-88138078 CTCACTCAGTGTCTGTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142079011 Original CRISPR TGGTGGAATGCTCCGTGATG GGG (reversed) Intergenic
No off target data available for this crispr