ID: 1142080019

View in Genome Browser
Species Human (GRCh38)
Location 16:88144011-88144033
Sequence TGCGCCGTTTCCCCTGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142080019_1142080024 5 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080024 16:88144039-88144061 AGAGGCAGAACCCGCCTGCTGGG No data
1142080019_1142080025 6 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080025 16:88144040-88144062 GAGGCAGAACCCGCCTGCTGGGG No data
1142080019_1142080032 20 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080032 16:88144054-88144076 CTGCTGGGGAGACAGGAGTGGGG No data
1142080019_1142080029 18 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080029 16:88144052-88144074 GCCTGCTGGGGAGACAGGAGTGG No data
1142080019_1142080026 13 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080026 16:88144047-88144069 AACCCGCCTGCTGGGGAGACAGG No data
1142080019_1142080033 25 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080033 16:88144059-88144081 GGGGAGACAGGAGTGGGGAGTGG No data
1142080019_1142080023 4 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080023 16:88144038-88144060 CAGAGGCAGAACCCGCCTGCTGG No data
1142080019_1142080031 19 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142080019 Original CRISPR TGCGCCGTTTCCCCTGCGCC TGG (reversed) Intergenic
No off target data available for this crispr