ID: 1142080031

View in Genome Browser
Species Human (GRCh38)
Location 16:88144053-88144075
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142080019_1142080031 19 Left 1142080019 16:88144011-88144033 CCAGGCGCAGGGGAAACGGCGCA No data
Right 1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG No data
1142080017_1142080031 26 Left 1142080017 16:88144004-88144026 CCACGTGCCAGGCGCAGGGGAAA No data
Right 1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142080031 Original CRISPR CCTGCTGGGGAGACAGGAGT GGG Intergenic
No off target data available for this crispr