ID: 1142080669

View in Genome Browser
Species Human (GRCh38)
Location 16:88147150-88147172
Sequence GGACGAGGCCACGGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142080662_1142080669 13 Left 1142080662 16:88147114-88147136 CCTGTCATCTCAAGTCCTTGGAA No data
Right 1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG No data
1142080658_1142080669 23 Left 1142080658 16:88147104-88147126 CCCTGGATTCCCTGTCATCTCAA No data
Right 1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG No data
1142080659_1142080669 22 Left 1142080659 16:88147105-88147127 CCTGGATTCCCTGTCATCTCAAG No data
Right 1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG No data
1142080665_1142080669 -2 Left 1142080665 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG No data
Right 1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG No data
1142080661_1142080669 14 Left 1142080661 16:88147113-88147135 CCCTGTCATCTCAAGTCCTTGGA No data
Right 1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142080669 Original CRISPR GGACGAGGCCACGGAGAGAC TGG Intergenic
No off target data available for this crispr