ID: 1142085284

View in Genome Browser
Species Human (GRCh38)
Location 16:88176732-88176754
Sequence CAGGGGCCGGGGCTGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142085284_1142085297 9 Left 1142085284 16:88176732-88176754 CCCACATACAGCCCCGGCCCCTG No data
Right 1142085297 16:88176764-88176786 CCAACGCCCAGCGCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142085284 Original CRISPR CAGGGGCCGGGGCTGTATGT GGG (reversed) Intergenic
No off target data available for this crispr