ID: 1142085554

View in Genome Browser
Species Human (GRCh38)
Location 16:88178309-88178331
Sequence TCCTCTCCTCCCGGTCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142085554_1142085564 6 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085564 16:88178338-88178360 GGAGCTGCAGGCTATGAACGGGG No data
1142085554_1142085566 23 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085566 16:88178355-88178377 ACGGGGCTGCAGGTTATGAATGG No data
1142085554_1142085568 25 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085568 16:88178357-88178379 GGGGCTGCAGGTTATGAATGGGG No data
1142085554_1142085562 4 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085562 16:88178336-88178358 GGGGAGCTGCAGGCTATGAACGG No data
1142085554_1142085561 -6 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085561 16:88178326-88178348 AGAGGAAGGAGGGGAGCTGCAGG No data
1142085554_1142085565 13 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data
1142085554_1142085567 24 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085567 16:88178356-88178378 CGGGGCTGCAGGTTATGAATGGG No data
1142085554_1142085563 5 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085563 16:88178337-88178359 GGGAGCTGCAGGCTATGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142085554 Original CRISPR TCCTCTCCTCCCGGTCGTCA GGG (reversed) Intergenic
900521368 1:3106936-3106958 CCCTCTCCTTCTGGTCGTCTGGG - Intronic
901534387 1:9872836-9872858 TCCTCTCCTCCAGCTCCTCCTGG - Intronic
902692332 1:18117713-18117735 TCCTCTCCTCCTGGGAATCAAGG - Intronic
902954869 1:19918728-19918750 TGCTCTCCTCCCTGCCCTCAAGG + Intergenic
909924786 1:81426507-81426529 TCCTCTGCTCCCGGCGGTGACGG - Intronic
912334057 1:108846272-108846294 TACTCTCCTCTCGGTCAGCAGGG + Intronic
915972218 1:160362840-160362862 CCCTCTCCTCCCGGCCCTCTAGG - Intergenic
918126084 1:181585184-181585206 ACCTCACCTCCCAGCCGTCATGG - Intronic
919773156 1:201175968-201175990 TCCTCTCCTGGGGGTCGACACGG + Intergenic
1064104434 10:12489357-12489379 TCCTCTCCTGCCTGGCTTCAGGG - Intronic
1067752100 10:48978342-48978364 TCCTCTCCTGCTGGCCGTCCAGG - Exonic
1069322320 10:67187474-67187496 TCTTCTCCTCCTTGTCTTCAAGG + Intronic
1073519774 10:104117172-104117194 GCCTCTCCACCTGGTCCTCACGG + Intergenic
1077326139 11:1964919-1964941 CCCTCGCCTCCCCGTCGGCAGGG + Intronic
1077375771 11:2204507-2204529 TCCTCACCTCCTGATCGTAAAGG - Intergenic
1079100009 11:17535238-17535260 TCCTCTCCTACCAGTCTTCCTGG + Intronic
1081781673 11:45717312-45717334 TCCTGTCCTCCCAGTGGTTACGG - Intergenic
1084388968 11:68862469-68862491 TCCTTTCCTCCAGGTTGCCAGGG - Intergenic
1084570262 11:69955505-69955527 GGCTCTCCTCCTGGTCTTCAGGG - Intergenic
1085574361 11:77589526-77589548 TCCTCTCCGCCCCGTGGTCCGGG + Intronic
1087198257 11:95321125-95321147 CCCTCACCTCCCGGACGGCACGG + Intergenic
1089441347 11:118520104-118520126 CCCTCTCCTCCAGCTGGTCAGGG + Intronic
1202809119 11_KI270721v1_random:20098-20120 CCCTCGCCTCCCCGTCGGCAGGG + Intergenic
1097777798 12:63668509-63668531 TGCGGACCTCCCGGTCGTCATGG + Exonic
1098286552 12:68913060-68913082 TCATCTCCTCCCGGATGTTAAGG + Intronic
1104310313 12:127648966-127648988 GCCCCTCCTTCCCGTCGTCAGGG + Intergenic
1109178858 13:59189095-59189117 TCCTCTCTACCCAGTCTTCAAGG - Intergenic
1112464965 13:99635698-99635720 TCCTCTTCCCCCAGTCTTCATGG - Intronic
1112578967 13:100662224-100662246 TCCTCTCCCCCAGGTGATCAGGG + Intronic
1115476580 14:33820403-33820425 TCCTTTTCTCCCTGTAGTCAGGG + Intergenic
1122075936 14:99234516-99234538 TCCAGTCCTCTCGGTCCTCAAGG - Intronic
1129698735 15:77755358-77755380 TCCTCTCTTCCAGGCCCTCATGG + Intronic
1130904941 15:88233695-88233717 TCCTCTCCTCCCTCTCCTCCTGG + Intronic
1131174227 15:90200194-90200216 TCCTCTCCTCCCGACTTTCAGGG - Intronic
1132235144 15:100214195-100214217 TCCTATCTTCCCTGTCGACATGG - Intronic
1132613795 16:830581-830603 TCCCCTCCTCCCTGTGGTCAAGG - Intergenic
1132799450 16:1744492-1744514 TCCTGTCCTCCCTGTGCTCAGGG + Intronic
1135975795 16:27108371-27108393 TCCCCTCCTCCCGCTCCTCTAGG - Intergenic
1136062100 16:27733722-27733744 TCCTCCCCCTCCAGTCGTCAGGG - Intronic
1136281190 16:29212386-29212408 TCCTCTCCTCCTGGTCTTCAGGG - Intergenic
1136504423 16:30693846-30693868 TCCTCTCATCCAAGTCTTCAAGG - Intergenic
1136552402 16:30988746-30988768 TCCTCTCATCCCAGTCCTGATGG + Exonic
1141288258 16:82692858-82692880 TCCTCACTTCCTGGTCTTCACGG + Intronic
1141664015 16:85456544-85456566 CCCTCCCCTCCCTGTCCTCAGGG - Intergenic
1142085554 16:88178309-88178331 TCCTCTCCTCCCGGTCGTCAGGG - Intergenic
1142762760 17:2051326-2051348 TCCTCCCCTCCCGGTCGCCTCGG - Intergenic
1144764549 17:17725397-17725419 TCCTCTCCTCCCGGCCCTGAGGG - Intronic
1151869052 17:76824211-76824233 TCCTCTCCTCACGGTCAGCCGGG + Intergenic
1151937828 17:77274138-77274160 TCCTTGCCTCCCGGTACTCATGG - Intergenic
1152687164 17:81700412-81700434 TCCTCTCCTCCCTGTTGCCCTGG + Intronic
1154483074 18:14855839-14855861 TCCTCACCTCCCAGACGTCGCGG + Intergenic
1154483434 18:14857238-14857260 TCCTCACCTCCCAGACATCACGG + Intergenic
1154483854 18:14858858-14858880 TCCTCACCTCCCAGACATCACGG + Intergenic
1156404583 18:36771929-36771951 TCTTCTCCTCCAAGTCTTCATGG + Intronic
1157618799 18:49003411-49003433 TCCTCTCCTCCCTGCCCTCTTGG + Intergenic
1161509044 19:4660563-4660585 CCCTCTCCTCCCTGTCCCCATGG + Intronic
1164555245 19:29246238-29246260 TCCTGTCCTCCCGCTAGGCAGGG - Intergenic
1165040272 19:33063935-33063957 TCCTCCGCTCCGGGTCGTCCAGG - Intronic
1166843254 19:45711689-45711711 TCCCCTCCTCCCGGCCGGCCCGG + Exonic
934506986 2:94902511-94902533 TCCTCTCCCCCCGGATGTAAGGG + Intergenic
935749540 2:106219270-106219292 CCCTCTCCTCCTGCCCGTCAAGG - Intergenic
938101310 2:128499810-128499832 TCCTCTTCTCCTGCTCTTCACGG - Intergenic
941188255 2:162344230-162344252 TCCGCTCGTCCCGCTCGTCATGG + Exonic
942165184 2:173234466-173234488 TCCTTTCCTCCCAGTTGCCAAGG - Intronic
945894487 2:215466808-215466830 ACCCCTCCTCCCAGTCTTCAAGG - Intergenic
946299751 2:218815336-218815358 TCCTCTCCTCCAGTGAGTCACGG + Intergenic
947224724 2:227828801-227828823 TCCTCTCCCCCTGGTCCCCAGGG - Intergenic
947452855 2:230224356-230224378 TCCTCTCCTCCCAGTCTCCATGG - Intronic
1169211543 20:3768446-3768468 GCCTCTGCTCCCGGTCTCCATGG + Intergenic
1172271764 20:33659176-33659198 TCCTCTTCTCCCTGTCTCCAAGG + Intronic
1172703222 20:36864874-36864896 TTCTTTCCTCCCGGGCGTCTGGG + Intergenic
1174735190 20:52959564-52959586 CCCTCTCCTCCAAGCCGTCAGGG - Intergenic
1175158256 20:56988803-56988825 TCCTCTCCTCCAGATTGTAATGG + Intergenic
1178369022 21:32011648-32011670 TCCTTTCCTCCCTTTCGTAAGGG - Intronic
1179269696 21:39841191-39841213 TCCTCTCCTCCCTGTTTGCATGG + Intergenic
1179344981 21:40547703-40547725 TCCTCTCCTCCCTGTGCTGAAGG - Intronic
1185338977 22:50283283-50283305 GCCCCTCCTCCCGGTCCTCCCGG + Intronic
961488437 3:127233817-127233839 TGCTCTCCTCCCTCTCCTCATGG - Intergenic
968986890 4:3880454-3880476 TCCCCTCCTCCCGCTCGAGAGGG - Intergenic
971427820 4:26533366-26533388 CCCTCTCCTCCCCATCATCATGG - Intergenic
973281435 4:48363885-48363907 CCCTCACCTCCCGGACGGCACGG + Intronic
973593512 4:52465131-52465153 CCCTCACCTCCCGGACGGCACGG - Intergenic
975814222 4:78201141-78201163 GCCTCTCCTCCCTGGGGTCAGGG + Intronic
983999145 4:174218690-174218712 TCCTCCACTCCCGGTGGCCAGGG + Intergenic
995870206 5:116736553-116736575 TCCTCTCCTCAGGGTCGTTTTGG + Intergenic
999006958 5:147992116-147992138 TGCTGTCCTCCCTGTCCTCAGGG - Intergenic
1002309466 5:178305987-178306009 TCCTCTCCTCCGGGTCCCCGAGG - Intronic
1006235237 6:32625170-32625192 TCCCCTCCTGCAGGTCTTCATGG + Intergenic
1007303529 6:40886874-40886896 TCCTCTTCTCCCTCTCCTCAAGG - Intergenic
1008601624 6:53101661-53101683 TCCTGTCCTCCCTGTCTTGAAGG - Intergenic
1011338733 6:86288293-86288315 TCCTCACCTCCTGGTATTCATGG + Intergenic
1014775814 6:125508396-125508418 CTCTGTCCTCCCTGTCGTCATGG - Intergenic
1019154185 6:170027891-170027913 TCCCCACCTCCCGCTCGCCAAGG - Intergenic
1020081179 7:5286640-5286662 TCCTTTCCTCCCGAAGGTCAGGG + Intronic
1020621832 7:10528158-10528180 GCCTCTCCTCCTGGTAGTTATGG + Intergenic
1020752549 7:12161040-12161062 TCCTCACATCCTGGTCCTCATGG + Intergenic
1022945814 7:35282414-35282436 TCCTTTCCTCTCTTTCGTCACGG - Intergenic
1023858480 7:44201262-44201284 TCCTCTCCGCCCGACCGCCACGG - Intronic
1024098632 7:46006454-46006476 TCCTCTCCTCTCAGTGGTCAGGG + Intergenic
1029118711 7:98252166-98252188 TCCGCTCCTCCCGGACGCCGAGG - Exonic
1032482307 7:132256784-132256806 TCCTCTGCTCCCTATGGTCAAGG - Intronic
1032735328 7:134687525-134687547 TCCTCTCCAGACAGTCGTCAGGG + Intergenic
1034381235 7:150695332-150695354 TCCTTTCCTCCTGGCCTTCAAGG + Intergenic
1036161130 8:6389417-6389439 GCCTCTCCTCCAGCTCCTCATGG - Intergenic
1037893295 8:22635538-22635560 TCCTGTCATCACCGTCGTCATGG - Intronic
1039141332 8:34391938-34391960 TCCTCACCTCCTGGTGTTCATGG - Intergenic
1049896303 9:114164-114186 TCCCCTGCTCCGGGTCGTCCAGG - Intergenic
1051343667 9:16133581-16133603 TCCTCTCCATGCGGTCTTCAGGG + Intergenic
1057802329 9:98198029-98198051 TCCTCTCCTCCCTGTCCACGTGG - Intergenic
1198644760 X:138793984-138794006 TCCTCTCCTCCAGGTGGTTTGGG + Intronic
1200058518 X:153473824-153473846 TCATCTCCTCCCTGTCTTCCTGG + Intronic
1200250812 X:154552827-154552849 TGCTCAGCTCCAGGTCGTCATGG + Intronic