ID: 1142085555

View in Genome Browser
Species Human (GRCh38)
Location 16:88178310-88178332
Sequence TTCCTCTCCTCCCGGTCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142085555_1142085565 12 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data
1142085555_1142085568 24 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085568 16:88178357-88178379 GGGGCTGCAGGTTATGAATGGGG No data
1142085555_1142085567 23 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085567 16:88178356-88178378 CGGGGCTGCAGGTTATGAATGGG No data
1142085555_1142085566 22 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085566 16:88178355-88178377 ACGGGGCTGCAGGTTATGAATGG No data
1142085555_1142085561 -7 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085561 16:88178326-88178348 AGAGGAAGGAGGGGAGCTGCAGG No data
1142085555_1142085563 4 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085563 16:88178337-88178359 GGGAGCTGCAGGCTATGAACGGG No data
1142085555_1142085564 5 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085564 16:88178338-88178360 GGAGCTGCAGGCTATGAACGGGG No data
1142085555_1142085562 3 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085562 16:88178336-88178358 GGGGAGCTGCAGGCTATGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142085555 Original CRISPR TTCCTCTCCTCCCGGTCGTC AGG (reversed) Intergenic
900521370 1:3106937-3106959 CCCCTCTCCTTCTGGTCGTCTGG - Intronic
900972361 1:5998614-5998636 TTCCTCTCCTCCCCGGGCTCTGG - Intronic
900986907 1:6078456-6078478 TTCCTGACCACCCTGTCGTCAGG - Intronic
901919423 1:12525755-12525777 CTCCTCTCCTCCCTGTCTGCTGG - Intergenic
904497651 1:30896085-30896107 TTCCTCTTCTCCCAGTCTTGGGG + Intronic
904576369 1:31507630-31507652 TTCCTCTCCTCCAGGGCCTGGGG - Intergenic
905548605 1:38818527-38818549 CTCCTCTGCTCGGGGTCGTCGGG + Intergenic
907898815 1:58718734-58718756 TTCCTCACCTCCAAGTCCTCAGG - Intergenic
908477740 1:64505786-64505808 TGACCCTCCTCCCGGTCGCCAGG + Intronic
912334056 1:108846271-108846293 TTACTCTCCTCTCGGTCAGCAGG + Intronic
919468892 1:197954442-197954464 TTCCTCTCCTCCCCATAGCCTGG - Intergenic
920108743 1:203572542-203572564 TTTCTCTCCTCCCGGTGGTTGGG - Intergenic
924350284 1:243108002-243108024 TTCCTTTCCTCCTGGTAGCCTGG + Intergenic
1066064472 10:31752142-31752164 CTCCTCTCCTCCCTGTCTCCTGG + Intergenic
1067027481 10:42857137-42857159 TTCCTCTCCTCCTGGGACTCTGG + Intergenic
1069592171 10:69648911-69648933 TTCCTCTACCCCCGGCCCTCAGG + Intergenic
1070780247 10:79133388-79133410 TTCCTTTCCTCCCGGAACTCCGG - Intronic
1071030693 10:81176968-81176990 CTCCTCTCCTCTTGGTCTTCTGG - Intergenic
1072998696 10:100269038-100269060 TTCCTTTCCCCGCAGTCGTCAGG - Intergenic
1073318048 10:102596727-102596749 TTCCTCTCCTCCCGATCTTCAGG - Intronic
1078197661 11:9149797-9149819 TTCCTCTCCTTCCTGTATTCAGG - Intronic
1084000540 11:66293261-66293283 TTCCTCTCCTCTTGGGCCTCTGG + Intronic
1085574360 11:77589525-77589547 CTCCTCTCCGCCCCGTGGTCCGG + Intronic
1089441345 11:118520103-118520125 TCCCTCTCCTCCAGCTGGTCAGG + Intronic
1090072887 11:123559843-123559865 TTCCTCTACTCCCAGGCCTCGGG + Intronic
1091625468 12:2117809-2117831 TTCCTCTCCTCCAGGTGGGAAGG - Intronic
1095945503 12:47751232-47751254 TTCCTCTCCTCCCCCACGCCTGG - Intronic
1096094449 12:48925203-48925225 TTCCTCTCCTCCCGGCTCCCAGG + Intronic
1096229505 12:49889322-49889344 TTCCCCTCCTCCCCCTCATCAGG + Intronic
1103918375 12:124387524-124387546 TTCCTGCCCTCCGGGTCCTCTGG + Intronic
1107508617 13:41060410-41060432 ATCATCACCTCCCGGGCGTCTGG + Intronic
1112199095 13:97258048-97258070 TTCCTCTCCTCCCAGACGGGGGG - Intronic
1119046154 14:71320620-71320642 TTCCTCCCCCACCGGTCGTTGGG + Intronic
1119205501 14:72790949-72790971 TCCCTCTGCTCCTGGTGGTCTGG + Intronic
1123427140 15:20181997-20182019 TTCCTCTCCTCCTGGGACTCTGG + Intergenic
1123536369 15:21188506-21188528 TTCCTCTCCTCCTGGGACTCTGG + Intergenic
1123970572 15:25504381-25504403 TTCCTTTCCTCCCAGCCGCCTGG - Intergenic
1124321015 15:28711723-28711745 TTCCACTCCTCCTGGTCGGGGGG + Intronic
1124481483 15:30083632-30083654 TTCCACTCCTCCTGGTCGGGGGG - Intronic
1124487938 15:30135728-30135750 TTCCACTCCTCCTGGTCGGGGGG - Intronic
1124522112 15:30413562-30413584 TTCCACTCCTCCTGGTCGGGGGG + Intronic
1124536553 15:30552656-30552678 TTCCACTCCTCCTGGTCGGGGGG - Intronic
1124543027 15:30604705-30604727 TTCCACTCCTCCTGGTCGGGGGG - Intronic
1124755591 15:32402593-32402615 TTCCACTCCTCCTGGTCGGGGGG + Intronic
1124762100 15:32454936-32454958 TTCCACTCCTCCTGGTCGGGGGG + Intronic
1124776530 15:32594132-32594154 TTCCACTCCTCCTGGTCGGGGGG - Intronic
1131174228 15:90200195-90200217 TTCCTCTCCTCCCGACTTTCAGG - Intronic
1136062101 16:27733723-27733745 TTCCTCCCCCTCCAGTCGTCAGG - Intronic
1136281191 16:29212387-29212409 TTCCTCTCCTCCTGGTCTTCAGG - Intergenic
1136478492 16:30527143-30527165 TCCCTCCCCTCCCGGGCCTCCGG + Intronic
1136534037 16:30888757-30888779 TGCCTCTCCTCCAGGCCCTCAGG + Intronic
1136857158 16:33667839-33667861 TTCCTCTCCTCCTGGGACTCTGG - Intergenic
1140353016 16:74280665-74280687 CTCCTCTCCTCCCGCTAGCCTGG + Intergenic
1140417370 16:74785575-74785597 TTCCTCTCCTCCCTGATGCCAGG - Intergenic
1141194548 16:81850633-81850655 TTCCTCTCCTGACTGTCTTCGGG - Intronic
1141395038 16:83696967-83696989 TTCCTCTCCTCTCGCTCCTCTGG + Intronic
1141769778 16:86082805-86082827 TTCCTCACTTCCTGGTGGTCAGG - Intergenic
1142085555 16:88178310-88178332 TTCCTCTCCTCCCGGTCGTCAGG - Intergenic
1203118731 16_KI270728v1_random:1516330-1516352 TTCCTCTCCTCCTGGGACTCTGG - Intergenic
1143398983 17:6628395-6628417 TTCCTTTCCACCCTGTGGTCGGG + Exonic
1144364172 17:14526056-14526078 CTCCTCTCCTCCCGCTAGCCTGG - Intergenic
1144764550 17:17725398-17725420 CTCCTCTCCTCCCGGCCCTGAGG - Intronic
1146189861 17:30755695-30755717 TTCTTTTCCTCCCGTTCATCTGG + Intergenic
1146334761 17:31960047-31960069 TTCTTTTCCTCCCGTTCATCTGG + Intronic
1146666266 17:34706232-34706254 TTCCCCTTCTCCCGGCTGTCAGG - Intergenic
1147539576 17:41346093-41346115 TTCTTCTCCTCCTGGTTGTGGGG + Exonic
1151381730 17:73730324-73730346 TTCCACTCCTCCCAGTCTTTTGG - Intergenic
1151869051 17:76824210-76824232 CTCCTCTCCTCACGGTCAGCCGG + Intergenic
1152292214 17:79446360-79446382 TTCCTCTCCTCCCAGCCCTGAGG - Intronic
1153040735 18:811776-811798 AACCTCTCCTCCCCGTCGCCGGG + Intronic
1160745734 19:709970-709992 GTCCCCTCCTCCCGGTGCTCGGG + Intronic
1164833283 19:31339531-31339553 TCCCTCCCCTCCCCGTAGTCTGG + Intronic
1167127671 19:47561891-47561913 TTCCTTTCTTCCCTGTCCTCAGG - Intergenic
936032649 2:109084719-109084741 TGCCTCTCCTCCTGGTCCTCAGG - Intergenic
939836955 2:147141484-147141506 TTCCTCTCCTCCCTGGCCCCTGG + Intergenic
940492322 2:154378655-154378677 TTCCTCCCCTCCCGATTCTCTGG + Intronic
1172703221 20:36864873-36864895 TTTCTTTCCTCCCGGGCGTCTGG + Intergenic
1173590613 20:44221964-44221986 TTCATCTCCTCCCATCCGTCTGG + Intergenic
1174735192 20:52959565-52959587 TCCCTCTCCTCCAAGCCGTCAGG - Intergenic
1176384395 21:6130881-6130903 CTCCTGTCCTCCGGGTTGTCAGG + Intergenic
1178369023 21:32011649-32011671 TTCCTTTCCTCCCTTTCGTAAGG - Intronic
1178465262 21:32841949-32841971 TTCCTTTCCTCCCGGGGGCCAGG - Intergenic
1178610142 21:34073212-34073234 TCCTTCTCCTCCCGGGCGGCGGG - Intronic
1179730246 21:43363671-43363693 TTCCTCTCCTGCAGGTCACCGGG - Intergenic
1179739077 21:43407368-43407390 CTCCTGTCCTCCGGGTTGTCAGG - Intergenic
1180078621 21:45475888-45475910 GCCTTCTCCTCCTGGTCGTCAGG - Intronic
1185044949 22:48524124-48524146 TTTCTCTCCTCCCTCCCGTCTGG + Intronic
961812215 3:129528450-129528472 TACCTCTCCTCCCTGACCTCAGG + Intergenic
963338951 3:144010694-144010716 TTCCTCCCCTCCCGATCCTTTGG + Intronic
967216350 3:187213762-187213784 TTCCTCTCCTCCCTGTAAGCTGG + Intergenic
970175781 4:13338105-13338127 TTCTTCTCCTCCCCATCCTCAGG - Intergenic
970617476 4:17781495-17781517 TTCCTCTCCTGCTGGTTCTCTGG + Exonic
975814221 4:78201140-78201162 TGCCTCTCCTCCCTGGGGTCAGG + Intronic
979251651 4:118572552-118572574 TTCCTTTCCTCCTGGTAGCCTGG - Intergenic
982672838 4:158342799-158342821 TTCCTGTCCTCCCGGGGGACAGG + Intronic
987589147 5:19900225-19900247 TTCCTCCCCTCCCCTTCTTCTGG - Intronic
989298591 5:39860942-39860964 TTCCTCTTCTCCCTTTCTTCAGG - Intergenic
1001009658 5:168086234-168086256 CTGCTCTCCTCCCGCTCCTCTGG + Intronic
1002455725 5:179344721-179344743 TTCCACCCCTCCCAGTCCTCGGG - Intronic
1005808717 6:29500282-29500304 TTCATCTCCTCCAGGACCTCTGG - Intergenic
1006951010 6:37820450-37820472 CTCCCCTCCTCCCCGTCCTCCGG + Intronic
1020045060 7:5034431-5034453 TGCCTCTCCTACAGGTCGTTTGG - Intronic
1020081178 7:5286639-5286661 TTCCTTTCCTCCCGAAGGTCAGG + Intronic
1020279175 7:6641697-6641719 TTCCTGTCCTCCTGATGGTCTGG + Intronic
1022452160 7:30525594-30525616 TTCCACTCCTCCTGGTTGTGGGG + Intronic
1024098631 7:46006453-46006475 TTCCTCTCCTCTCAGTGGTCAGG + Intergenic
1031971564 7:128068522-128068544 TTCCTCTTCTCCCCATTGTCTGG - Intronic
1033667166 7:143452418-143452440 TTCCTAGCCTCCTGGTCTTCTGG - Intergenic
1034218117 7:149423076-149423098 TTCCTCTCGTTCAGGTCGCCTGG - Intergenic
1035364904 7:158342827-158342849 TTCCTGAGCTCCCGGTGGTCTGG - Intronic
1035630747 8:1104963-1104985 CTCCTCTGCTCCAGGGCGTCTGG - Intergenic
1037959160 8:23083722-23083744 TTCCTCCCCTCCCTGCCTTCAGG + Intergenic
1047251080 8:123182537-123182559 TTCCTCTCCTCCCAGCCGCAGGG - Exonic
1049064565 8:140302641-140302663 TTCCTCTCGACCGGTTCGTCTGG - Intronic
1060594870 9:124841696-124841718 TTCCTCTCCTCCCTGGAGCCTGG - Intergenic
1060794440 9:126504581-126504603 TCCCTTTCCTCCCGTTCCTCTGG - Exonic
1185778291 X:2823953-2823975 TTTCTCTCCTCCCTGTTGCCGGG - Intergenic
1186243801 X:7598675-7598697 TCCCTCTCCTCCCTGCAGTCAGG - Intergenic
1194906633 X:99585112-99585134 TTCATCTCCTCCAGGTTTTCTGG - Intergenic
1198073217 X:133169964-133169986 CTCCTCTCCTCCCGATAGTCTGG - Intergenic
1198644759 X:138793983-138794005 ATCCTCTCCTCCAGGTGGTTTGG + Intronic