ID: 1142085560

View in Genome Browser
Species Human (GRCh38)
Location 16:88178318-88178340
Sequence TCCCCTCCTTCCTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142085560_1142085568 16 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085568 16:88178357-88178379 GGGGCTGCAGGTTATGAATGGGG No data
1142085560_1142085564 -3 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085564 16:88178338-88178360 GGAGCTGCAGGCTATGAACGGGG No data
1142085560_1142085567 15 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085567 16:88178356-88178378 CGGGGCTGCAGGTTATGAATGGG No data
1142085560_1142085566 14 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085566 16:88178355-88178377 ACGGGGCTGCAGGTTATGAATGG No data
1142085560_1142085569 24 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085569 16:88178365-88178387 AGGTTATGAATGGGGCACTCCGG No data
1142085560_1142085563 -4 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085563 16:88178337-88178359 GGGAGCTGCAGGCTATGAACGGG No data
1142085560_1142085562 -5 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085562 16:88178336-88178358 GGGGAGCTGCAGGCTATGAACGG No data
1142085560_1142085565 4 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142085560 Original CRISPR TCCCCTCCTTCCTCTCCTCC CGG (reversed) Intergenic
No off target data available for this crispr