ID: 1142085565

View in Genome Browser
Species Human (GRCh38)
Location 16:88178345-88178367
Sequence CAGGCTATGAACGGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142085560_1142085565 4 Left 1142085560 16:88178318-88178340 CCGGGAGGAGAGGAAGGAGGGGA No data
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data
1142085554_1142085565 13 Left 1142085554 16:88178309-88178331 CCCTGACGACCGGGAGGAGAGGA 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data
1142085555_1142085565 12 Left 1142085555 16:88178310-88178332 CCTGACGACCGGGAGGAGAGGAA 0: 1
1: 0
2: 2
3: 6
4: 112
Right 1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142085565 Original CRISPR CAGGCTATGAACGGGGCTGC AGG Intergenic
No off target data available for this crispr