ID: 1142086081

View in Genome Browser
Species Human (GRCh38)
Location 16:88183202-88183224
Sequence GTCGCGGGCGTTGCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142086070_1142086081 15 Left 1142086070 16:88183164-88183186 CCACTGCCAGGTGCTGATGAAAA No data
Right 1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG No data
1142086071_1142086081 9 Left 1142086071 16:88183170-88183192 CCAGGTGCTGATGAAAATGCCGC No data
Right 1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG No data
1142086075_1142086081 -10 Left 1142086075 16:88183189-88183211 CCGCGCGCCTGGAGTCGCGGGCG No data
Right 1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142086081 Original CRISPR GTCGCGGGCGTTGCTGGCGG GGG Intergenic
No off target data available for this crispr