ID: 1142087960

View in Genome Browser
Species Human (GRCh38)
Location 16:88194386-88194408
Sequence CAGAGAAACTACTCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142087960_1142087969 25 Left 1142087960 16:88194386-88194408 CCCACTTGGGAGTAGTTTCTCTG No data
Right 1142087969 16:88194434-88194456 AAGAAATCGCGTCCGCTAAGTGG 0: 1
1: 1
2: 0
3: 1
4: 24
1142087960_1142087963 -6 Left 1142087960 16:88194386-88194408 CCCACTTGGGAGTAGTTTCTCTG No data
Right 1142087963 16:88194403-88194425 TCTCTGCACGCACCAGGCAGTGG No data
1142087960_1142087966 2 Left 1142087960 16:88194386-88194408 CCCACTTGGGAGTAGTTTCTCTG No data
Right 1142087966 16:88194411-88194433 CGCACCAGGCAGTGGGACCAGGG No data
1142087960_1142087965 1 Left 1142087960 16:88194386-88194408 CCCACTTGGGAGTAGTTTCTCTG No data
Right 1142087965 16:88194410-88194432 ACGCACCAGGCAGTGGGACCAGG No data
1142087960_1142087964 -5 Left 1142087960 16:88194386-88194408 CCCACTTGGGAGTAGTTTCTCTG No data
Right 1142087964 16:88194404-88194426 CTCTGCACGCACCAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142087960 Original CRISPR CAGAGAAACTACTCCCAAGT GGG (reversed) Intergenic
No off target data available for this crispr