ID: 1142088504

View in Genome Browser
Species Human (GRCh38)
Location 16:88197621-88197643
Sequence GGCCCCAGGAACCATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142088504_1142088512 6 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088512 16:88197650-88197672 CTGACAGCCACCCAGTACGATGG No data
1142088504_1142088518 20 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088504_1142088513 11 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088504_1142088514 12 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088514 16:88197656-88197678 GCCACCCAGTACGATGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142088504 Original CRISPR GGCCCCAGGAACCATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr