ID: 1142088513

View in Genome Browser
Species Human (GRCh38)
Location 16:88197655-88197677
Sequence AGCCACCCAGTACGATGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142088504_1142088513 11 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088506_1142088513 7 Left 1142088506 16:88197625-88197647 CCCCATGGTTCCTGGGGCCCAGA No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088510_1142088513 -10 Left 1142088510 16:88197642-88197664 CCCAGAGTCTGACAGCCACCCAG No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088509_1142088513 -3 Left 1142088509 16:88197635-88197657 CCTGGGGCCCAGAGTCTGACAGC No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088505_1142088513 10 Left 1142088505 16:88197622-88197644 CCTCCCCATGGTTCCTGGGGCCC No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088508_1142088513 5 Left 1142088508 16:88197627-88197649 CCATGGTTCCTGGGGCCCAGAGT No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088507_1142088513 6 Left 1142088507 16:88197626-88197648 CCCATGGTTCCTGGGGCCCAGAG No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data
1142088499_1142088513 23 Left 1142088499 16:88197609-88197631 CCTCAACACTTACCCTCCCCATG No data
Right 1142088513 16:88197655-88197677 AGCCACCCAGTACGATGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142088513 Original CRISPR AGCCACCCAGTACGATGGTG TGG Intergenic
No off target data available for this crispr