ID: 1142088518

View in Genome Browser
Species Human (GRCh38)
Location 16:88197664-88197686
Sequence GTACGATGGTGTGGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142088505_1142088518 19 Left 1142088505 16:88197622-88197644 CCTCCCCATGGTTCCTGGGGCCC No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088507_1142088518 15 Left 1142088507 16:88197626-88197648 CCCATGGTTCCTGGGGCCCAGAG No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088508_1142088518 14 Left 1142088508 16:88197627-88197649 CCATGGTTCCTGGGGCCCAGAGT No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088509_1142088518 6 Left 1142088509 16:88197635-88197657 CCTGGGGCCCAGAGTCTGACAGC No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088510_1142088518 -1 Left 1142088510 16:88197642-88197664 CCCAGAGTCTGACAGCCACCCAG No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088511_1142088518 -2 Left 1142088511 16:88197643-88197665 CCAGAGTCTGACAGCCACCCAGT No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088506_1142088518 16 Left 1142088506 16:88197625-88197647 CCCCATGGTTCCTGGGGCCCAGA No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data
1142088504_1142088518 20 Left 1142088504 16:88197621-88197643 CCCTCCCCATGGTTCCTGGGGCC No data
Right 1142088518 16:88197664-88197686 GTACGATGGTGTGGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142088518 Original CRISPR GTACGATGGTGTGGGCCTTG TGG Intergenic
No off target data available for this crispr