ID: 1142094825

View in Genome Browser
Species Human (GRCh38)
Location 16:88233757-88233779
Sequence GGACCCCGATGGGGACGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142094820_1142094825 -2 Left 1142094820 16:88233736-88233758 CCTGGAGGCAGATCTGTTTCAGG No data
Right 1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG No data
1142094819_1142094825 6 Left 1142094819 16:88233728-88233750 CCGAGGTGCCTGGAGGCAGATCT No data
Right 1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG No data
1142094814_1142094825 30 Left 1142094814 16:88233704-88233726 CCGTGATGGGCTGGCCTGGCTGT No data
Right 1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG No data
1142094816_1142094825 16 Left 1142094816 16:88233718-88233740 CCTGGCTGTGCCGAGGTGCCTGG No data
Right 1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142094825 Original CRISPR GGACCCCGATGGGGACGTAG AGG Intergenic