ID: 1142099918

View in Genome Browser
Species Human (GRCh38)
Location 16:88265645-88265667
Sequence CTTCACAGACGGGAACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142099918_1142099934 23 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099918_1142099929 14 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099929 16:88265682-88265704 CCCGCCCGTCCTGGGTCACAGGG No data
1142099918_1142099925 5 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099925 16:88265673-88265695 CACAGGAAACCCGCCCGTCCTGG No data
1142099918_1142099926 6 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099926 16:88265674-88265696 ACAGGAAACCCGCCCGTCCTGGG No data
1142099918_1142099927 13 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099927 16:88265681-88265703 ACCCGCCCGTCCTGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142099918 Original CRISPR CTTCACAGACGGGAACATTG AGG (reversed) Intergenic
No off target data available for this crispr