ID: 1142099923

View in Genome Browser
Species Human (GRCh38)
Location 16:88265656-88265678
Sequence CCTGTGCCCCACTTCACAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142099923_1142099938 28 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099938 16:88265707-88265729 CTGCAGGAGCAGACGGGAGTGGG No data
1142099923_1142099936 22 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099936 16:88265701-88265723 AGGGTGCTGCAGGAGCAGACGGG No data
1142099923_1142099935 21 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099935 16:88265700-88265722 CAGGGTGCTGCAGGAGCAGACGG No data
1142099923_1142099926 -5 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099926 16:88265674-88265696 ACAGGAAACCCGCCCGTCCTGGG No data
1142099923_1142099925 -6 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099925 16:88265673-88265695 CACAGGAAACCCGCCCGTCCTGG No data
1142099923_1142099934 12 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099923_1142099929 3 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099929 16:88265682-88265704 CCCGCCCGTCCTGGGTCACAGGG No data
1142099923_1142099937 27 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099937 16:88265706-88265728 GCTGCAGGAGCAGACGGGAGTGG No data
1142099923_1142099927 2 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099927 16:88265681-88265703 ACCCGCCCGTCCTGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142099923 Original CRISPR CCTGTGCCCCACTTCACAGA CGG (reversed) Intergenic
No off target data available for this crispr