ID: 1142099934

View in Genome Browser
Species Human (GRCh38)
Location 16:88265691-88265713
Sequence CCTGGGTCACAGGGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142099917_1142099934 29 Left 1142099917 16:88265639-88265661 CCTCAGCCTCAATGTTCCCGTCT No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099922_1142099934 13 Left 1142099922 16:88265655-88265677 CCCGTCTGTGAAGTGGGGCACAG No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099918_1142099934 23 Left 1142099918 16:88265645-88265667 CCTCAATGTTCCCGTCTGTGAAG No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099923_1142099934 12 Left 1142099923 16:88265656-88265678 CCGTCTGTGAAGTGGGGCACAGG No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data
1142099916_1142099934 30 Left 1142099916 16:88265638-88265660 CCCTCAGCCTCAATGTTCCCGTC No data
Right 1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142099934 Original CRISPR CCTGGGTCACAGGGTGCTGC AGG Intergenic
No off target data available for this crispr