ID: 1142100227

View in Genome Browser
Species Human (GRCh38)
Location 16:88267099-88267121
Sequence CAGTGTGAGCCGCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142100227_1142100233 -2 Left 1142100227 16:88267099-88267121 CCTTCTCCCTGCGGCTCACACTG No data
Right 1142100233 16:88267120-88267142 TGGCTGGCGGCACCCTCCATCGG No data
1142100227_1142100237 20 Left 1142100227 16:88267099-88267121 CCTTCTCCCTGCGGCTCACACTG No data
Right 1142100237 16:88267142-88267164 GCGCCCTCACTCTCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142100227 Original CRISPR CAGTGTGAGCCGCAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr