ID: 1142100797

View in Genome Browser
Species Human (GRCh38)
Location 16:88269992-88270014
Sequence TCGCGTCCTGCATTTCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142100795_1142100797 -10 Left 1142100795 16:88269979-88270001 CCAGGATCTAGGTTCGCGTCCTG No data
Right 1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG No data
1142100789_1142100797 30 Left 1142100789 16:88269939-88269961 CCGGCTCCTTTAGAGCAGAGTGT No data
Right 1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG No data
1142100790_1142100797 24 Left 1142100790 16:88269945-88269967 CCTTTAGAGCAGAGTGTTTTCTA No data
Right 1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG No data
1142100793_1142100797 -3 Left 1142100793 16:88269972-88269994 CCACCATCCAGGATCTAGGTTCG No data
Right 1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG No data
1142100794_1142100797 -6 Left 1142100794 16:88269975-88269997 CCATCCAGGATCTAGGTTCGCGT No data
Right 1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142100797 Original CRISPR TCGCGTCCTGCATTTCTAGG TGG Intergenic
No off target data available for this crispr