ID: 1142102994

View in Genome Browser
Species Human (GRCh38)
Location 16:88285478-88285500
Sequence TGCCACAGCCAGCGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142102988_1142102994 8 Left 1142102988 16:88285447-88285469 CCACACTGTCACAGCAGAATCTT No data
Right 1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142102994 Original CRISPR TGCCACAGCCAGCGTGGGCA GGG Intergenic
No off target data available for this crispr