ID: 1142103049

View in Genome Browser
Species Human (GRCh38)
Location 16:88285722-88285744
Sequence CACCACTCAGAGAGGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142103049_1142103060 -5 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103060 16:88285740-88285762 TGGTGGGCAGTGAGGGGGTTGGG No data
1142103049_1142103059 -6 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103059 16:88285739-88285761 GTGGTGGGCAGTGAGGGGGTTGG No data
1142103049_1142103061 7 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103061 16:88285752-88285774 AGGGGGTTGGGAGTGCCCTCTGG No data
1142103049_1142103063 12 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103063 16:88285757-88285779 GTTGGGAGTGCCCTCTGGCAGGG No data
1142103049_1142103062 11 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103062 16:88285756-88285778 GGTTGGGAGTGCCCTCTGGCAGG No data
1142103049_1142103058 -10 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103058 16:88285735-88285757 CTGAGTGGTGGGCAGTGAGGGGG No data
1142103049_1142103064 13 Left 1142103049 16:88285722-88285744 CCCTGGGCCCTCTCTGAGTGGTG No data
Right 1142103064 16:88285758-88285780 TTGGGAGTGCCCTCTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142103049 Original CRISPR CACCACTCAGAGAGGGCCCA GGG (reversed) Intergenic
No off target data available for this crispr