ID: 1142105264

View in Genome Browser
Species Human (GRCh38)
Location 16:88299160-88299182
Sequence CCACCCAAGCTGCCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105264_1142105282 24 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105282 16:88299207-88299229 TTGGGGTGGGGAGGGCTTCCTGG No data
1142105264_1142105272 -3 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105272 16:88299180-88299202 TGGGGAGGGCTTCCTGGAGGAGG No data
1142105264_1142105273 5 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105273 16:88299188-88299210 GCTTCCTGGAGGAGGCAGCTTGG No data
1142105264_1142105278 11 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105278 16:88299194-88299216 TGGAGGAGGCAGCTTGGGGTGGG No data
1142105264_1142105283 27 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105283 16:88299210-88299232 GGGTGGGGAGGGCTTCCTGGAGG No data
1142105264_1142105280 15 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105280 16:88299198-88299220 GGAGGCAGCTTGGGGTGGGGAGG No data
1142105264_1142105274 6 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105274 16:88299189-88299211 CTTCCTGGAGGAGGCAGCTTGGG No data
1142105264_1142105279 12 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105279 16:88299195-88299217 GGAGGAGGCAGCTTGGGGTGGGG No data
1142105264_1142105271 -6 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105271 16:88299177-88299199 GGGTGGGGAGGGCTTCCTGGAGG No data
1142105264_1142105275 7 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105275 16:88299190-88299212 TTCCTGGAGGAGGCAGCTTGGGG No data
1142105264_1142105277 10 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105277 16:88299193-88299215 CTGGAGGAGGCAGCTTGGGGTGG No data
1142105264_1142105284 30 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105284 16:88299213-88299235 TGGGGAGGGCTTCCTGGAGGAGG No data
1142105264_1142105281 16 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105281 16:88299199-88299221 GAGGCAGCTTGGGGTGGGGAGGG No data
1142105264_1142105270 -9 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105270 16:88299174-88299196 CTTGGGTGGGGAGGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105264 Original CRISPR CCACCCAAGCTGCCTCCTCC AGG (reversed) Intergenic