ID: 1142105276

View in Genome Browser
Species Human (GRCh38)
Location 16:88299192-88299214
Sequence CACCCCAAGCTGCCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105276_1142105289 13 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105289 16:88299228-88299250 GGAGGAGGCAGCTTGCGGCGGGG No data
1142105276_1142105282 -8 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105282 16:88299207-88299229 TTGGGGTGGGGAGGGCTTCCTGG No data
1142105276_1142105284 -2 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105284 16:88299213-88299235 TGGGGAGGGCTTCCTGGAGGAGG No data
1142105276_1142105285 8 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105285 16:88299223-88299245 TTCCTGGAGGAGGCAGCTTGCGG No data
1142105276_1142105288 12 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105288 16:88299227-88299249 TGGAGGAGGCAGCTTGCGGCGGG No data
1142105276_1142105291 25 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105291 16:88299240-88299262 TTGCGGCGGGGTAGGCTTCCTGG No data
1142105276_1142105292 28 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105292 16:88299243-88299265 CGGCGGGGTAGGCTTCCTGGAGG No data
1142105276_1142105290 17 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105290 16:88299232-88299254 GAGGCAGCTTGCGGCGGGGTAGG No data
1142105276_1142105287 11 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105287 16:88299226-88299248 CTGGAGGAGGCAGCTTGCGGCGG No data
1142105276_1142105283 -5 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105283 16:88299210-88299232 GGGTGGGGAGGGCTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105276 Original CRISPR CACCCCAAGCTGCCTCCTCC AGG (reversed) Intergenic