ID: 1142105284

View in Genome Browser
Species Human (GRCh38)
Location 16:88299213-88299235
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105276_1142105284 -2 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105284 16:88299213-88299235 TGGGGAGGGCTTCCTGGAGGAGG No data
1142105264_1142105284 30 Left 1142105264 16:88299160-88299182 CCTGGAGGAGGCAGCTTGGGTGG No data
Right 1142105284 16:88299213-88299235 TGGGGAGGGCTTCCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105284 Original CRISPR TGGGGAGGGCTTCCTGGAGG AGG Intergenic