ID: 1142105287

View in Genome Browser
Species Human (GRCh38)
Location 16:88299226-88299248
Sequence CTGGAGGAGGCAGCTTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105276_1142105287 11 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105287 16:88299226-88299248 CTGGAGGAGGCAGCTTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105287 Original CRISPR CTGGAGGAGGCAGCTTGCGG CGG Intergenic