ID: 1142105289 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:88299228-88299250 |
Sequence | GGAGGAGGCAGCTTGCGGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142105276_1142105289 | 13 | Left | 1142105276 | 16:88299192-88299214 | CCTGGAGGAGGCAGCTTGGGGTG | No data | ||
Right | 1142105289 | 16:88299228-88299250 | GGAGGAGGCAGCTTGCGGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142105289 | Original CRISPR | GGAGGAGGCAGCTTGCGGCG GGG | Intergenic | ||