ID: 1142105292

View in Genome Browser
Species Human (GRCh38)
Location 16:88299243-88299265
Sequence CGGCGGGGTAGGCTTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105286_1142105292 -5 Left 1142105286 16:88299225-88299247 CCTGGAGGAGGCAGCTTGCGGCG No data
Right 1142105292 16:88299243-88299265 CGGCGGGGTAGGCTTCCTGGAGG No data
1142105276_1142105292 28 Left 1142105276 16:88299192-88299214 CCTGGAGGAGGCAGCTTGGGGTG No data
Right 1142105292 16:88299243-88299265 CGGCGGGGTAGGCTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105292 Original CRISPR CGGCGGGGTAGGCTTCCTGG AGG Intergenic