ID: 1142105426

View in Genome Browser
Species Human (GRCh38)
Location 16:88299868-88299890
Sequence CTCTGAGGCCAGCACTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105418_1142105426 12 Left 1142105418 16:88299833-88299855 CCATGGGGGTTCCAGCCACTCTG No data
Right 1142105426 16:88299868-88299890 CTCTGAGGCCAGCACTGCCCCGG No data
1142105422_1142105426 -3 Left 1142105422 16:88299848-88299870 CCACTCTGGCTGGAGTTTCCCTC No data
Right 1142105426 16:88299868-88299890 CTCTGAGGCCAGCACTGCCCCGG No data
1142105421_1142105426 1 Left 1142105421 16:88299844-88299866 CCAGCCACTCTGGCTGGAGTTTC No data
Right 1142105426 16:88299868-88299890 CTCTGAGGCCAGCACTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105426 Original CRISPR CTCTGAGGCCAGCACTGCCC CGG Intergenic
No off target data available for this crispr