ID: 1142105844

View in Genome Browser
Species Human (GRCh38)
Location 16:88302228-88302250
Sequence TCCCGCTGCTGTCGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142105840_1142105844 -7 Left 1142105840 16:88302212-88302234 CCGTCTGACCCGCTGTTCCCGCT No data
Right 1142105844 16:88302228-88302250 TCCCGCTGCTGTCGGAGTGCTGG No data
1142105839_1142105844 -3 Left 1142105839 16:88302208-88302230 CCTGCCGTCTGACCCGCTGTTCC No data
Right 1142105844 16:88302228-88302250 TCCCGCTGCTGTCGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142105844 Original CRISPR TCCCGCTGCTGTCGGAGTGC TGG Intergenic
No off target data available for this crispr