ID: 1142109064

View in Genome Browser
Species Human (GRCh38)
Location 16:88321663-88321685
Sequence CTCATAAGGCCTCACCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142109062_1142109064 -10 Left 1142109062 16:88321650-88321672 CCCTCGGATTCTGCTCATAAGGC No data
Right 1142109064 16:88321663-88321685 CTCATAAGGCCTCACCTGATTGG No data
1142109059_1142109064 10 Left 1142109059 16:88321630-88321652 CCTCATCTGATTGGATGTGACCC No data
Right 1142109064 16:88321663-88321685 CTCATAAGGCCTCACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142109064 Original CRISPR CTCATAAGGCCTCACCTGAT TGG Intergenic
No off target data available for this crispr