ID: 1142109296

View in Genome Browser
Species Human (GRCh38)
Location 16:88322763-88322785
Sequence TCCTGAAGGTGGGTGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142109296_1142109316 28 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109316 16:88322814-88322836 TGGACTTGGCCCAGGACTTGGGG No data
1142109296_1142109313 20 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109313 16:88322806-88322828 CCATCGAATGGACTTGGCCCAGG No data
1142109296_1142109314 26 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109314 16:88322812-88322834 AATGGACTTGGCCCAGGACTTGG No data
1142109296_1142109311 14 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109311 16:88322800-88322822 GGGGAACCATCGAATGGACTTGG No data
1142109296_1142109310 8 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109310 16:88322794-88322816 GGGATGGGGGAACCATCGAATGG No data
1142109296_1142109306 -7 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109306 16:88322779-88322801 TTCAGGAGAATCCGTGGGATGGG No data
1142109296_1142109315 27 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109315 16:88322813-88322835 ATGGACTTGGCCCAGGACTTGGG No data
1142109296_1142109307 -6 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109307 16:88322780-88322802 TCAGGAGAATCCGTGGGATGGGG No data
1142109296_1142109305 -8 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109305 16:88322778-88322800 CTTCAGGAGAATCCGTGGGATGG No data
1142109296_1142109308 -5 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109308 16:88322781-88322803 CAGGAGAATCCGTGGGATGGGGG No data
1142109296_1142109317 29 Left 1142109296 16:88322763-88322785 CCCGTGCCCACCCACCTTCAGGA No data
Right 1142109317 16:88322815-88322837 GGACTTGGCCCAGGACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142109296 Original CRISPR TCCTGAAGGTGGGTGGGCAC GGG (reversed) Intergenic
No off target data available for this crispr