ID: 1142110826

View in Genome Browser
Species Human (GRCh38)
Location 16:88330216-88330238
Sequence ACGGGACCTGTGGCATCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142110820_1142110826 29 Left 1142110820 16:88330164-88330186 CCTAGGCAATGGGCACTTATGCT No data
Right 1142110826 16:88330216-88330238 ACGGGACCTGTGGCATCCTGTGG No data
1142110819_1142110826 30 Left 1142110819 16:88330163-88330185 CCCTAGGCAATGGGCACTTATGC No data
Right 1142110826 16:88330216-88330238 ACGGGACCTGTGGCATCCTGTGG No data
1142110822_1142110826 -4 Left 1142110822 16:88330197-88330219 CCTGTGAATGCACTTGCACACGG No data
Right 1142110826 16:88330216-88330238 ACGGGACCTGTGGCATCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142110826 Original CRISPR ACGGGACCTGTGGCATCCTG TGG Intergenic
No off target data available for this crispr