ID: 1142113082

View in Genome Browser
Species Human (GRCh38)
Location 16:88342333-88342355
Sequence ACCTCAGGAAGATCTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142113072_1142113082 13 Left 1142113072 16:88342297-88342319 CCTGCCTGCATCTCTCATGTTCC No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113068_1142113082 21 Left 1142113068 16:88342289-88342311 CCTCCCCTCCTGCCTGCATCTCT No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113074_1142113082 9 Left 1142113074 16:88342301-88342323 CCTGCATCTCTCATGTTCCTGGA No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113071_1142113082 16 Left 1142113071 16:88342294-88342316 CCTCCTGCCTGCATCTCTCATGT No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113070_1142113082 17 Left 1142113070 16:88342293-88342315 CCCTCCTGCCTGCATCTCTCATG No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113069_1142113082 18 Left 1142113069 16:88342292-88342314 CCCCTCCTGCCTGCATCTCTCAT No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data
1142113076_1142113082 -8 Left 1142113076 16:88342318-88342340 CCTGGAGCTCCAGGAACCTCAGG No data
Right 1142113082 16:88342333-88342355 ACCTCAGGAAGATCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142113082 Original CRISPR ACCTCAGGAAGATCTCATGG GGG Intergenic
No off target data available for this crispr