ID: 1142115758 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:88355361-88355383 |
| Sequence | GAACCAGAGGCCACTTTCAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142115758_1142115769 | 12 | Left | 1142115758 | 16:88355361-88355383 | CCCCTGAAAGTGGCCTCTGGTTC | No data | ||
| Right | 1142115769 | 16:88355396-88355418 | TCCCGCCACCATGGCGCTCACGG | No data | ||||
| 1142115758_1142115764 | 3 | Left | 1142115758 | 16:88355361-88355383 | CCCCTGAAAGTGGCCTCTGGTTC | No data | ||
| Right | 1142115764 | 16:88355387-88355409 | CCCTCCCCGTCCCGCCACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142115758 | Original CRISPR | GAACCAGAGGCCACTTTCAG GGG (reversed) | Intergenic | ||