ID: 1142115758

View in Genome Browser
Species Human (GRCh38)
Location 16:88355361-88355383
Sequence GAACCAGAGGCCACTTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142115758_1142115764 3 Left 1142115758 16:88355361-88355383 CCCCTGAAAGTGGCCTCTGGTTC No data
Right 1142115764 16:88355387-88355409 CCCTCCCCGTCCCGCCACCATGG No data
1142115758_1142115769 12 Left 1142115758 16:88355361-88355383 CCCCTGAAAGTGGCCTCTGGTTC No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142115758 Original CRISPR GAACCAGAGGCCACTTTCAG GGG (reversed) Intergenic