ID: 1142115764

View in Genome Browser
Species Human (GRCh38)
Location 16:88355387-88355409
Sequence CCCTCCCCGTCCCGCCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142115760_1142115764 1 Left 1142115760 16:88355363-88355385 CCTGAAAGTGGCCTCTGGTTCCT No data
Right 1142115764 16:88355387-88355409 CCCTCCCCGTCCCGCCACCATGG No data
1142115758_1142115764 3 Left 1142115758 16:88355361-88355383 CCCCTGAAAGTGGCCTCTGGTTC No data
Right 1142115764 16:88355387-88355409 CCCTCCCCGTCCCGCCACCATGG No data
1142115759_1142115764 2 Left 1142115759 16:88355362-88355384 CCCTGAAAGTGGCCTCTGGTTCC No data
Right 1142115764 16:88355387-88355409 CCCTCCCCGTCCCGCCACCATGG No data
1142115761_1142115764 -10 Left 1142115761 16:88355374-88355396 CCTCTGGTTCCTACCCTCCCCGT No data
Right 1142115764 16:88355387-88355409 CCCTCCCCGTCCCGCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142115764 Original CRISPR CCCTCCCCGTCCCGCCACCA TGG Intergenic
No off target data available for this crispr