ID: 1142115769

View in Genome Browser
Species Human (GRCh38)
Location 16:88355396-88355418
Sequence TCCCGCCACCATGGCGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142115759_1142115769 11 Left 1142115759 16:88355362-88355384 CCCTGAAAGTGGCCTCTGGTTCC No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data
1142115762_1142115769 -10 Left 1142115762 16:88355383-88355405 CCTACCCTCCCCGTCCCGCCACC No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data
1142115758_1142115769 12 Left 1142115758 16:88355361-88355383 CCCCTGAAAGTGGCCTCTGGTTC No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data
1142115760_1142115769 10 Left 1142115760 16:88355363-88355385 CCTGAAAGTGGCCTCTGGTTCCT No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data
1142115761_1142115769 -1 Left 1142115761 16:88355374-88355396 CCTCTGGTTCCTACCCTCCCCGT No data
Right 1142115769 16:88355396-88355418 TCCCGCCACCATGGCGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142115769 Original CRISPR TCCCGCCACCATGGCGCTCA CGG Intergenic
No off target data available for this crispr