ID: 1142118664

View in Genome Browser
Species Human (GRCh38)
Location 16:88375031-88375053
Sequence CTGTGCACACAGCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142118659_1142118664 -9 Left 1142118659 16:88375017-88375039 CCGAAGCGCTGGGACTGTGCACA No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118658_1142118664 -2 Left 1142118658 16:88375010-88375032 CCAGGCACCGAAGCGCTGGGACT No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118657_1142118664 -1 Left 1142118657 16:88375009-88375031 CCCAGGCACCGAAGCGCTGGGAC No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118651_1142118664 22 Left 1142118651 16:88374986-88375008 CCCAGCTGCATTTGCAGAAACCG No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118654_1142118664 2 Left 1142118654 16:88375006-88375028 CCGCCCAGGCACCGAAGCGCTGG No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118650_1142118664 23 Left 1142118650 16:88374985-88375007 CCCCAGCTGCATTTGCAGAAACC No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data
1142118652_1142118664 21 Left 1142118652 16:88374987-88375009 CCAGCTGCATTTGCAGAAACCGC No data
Right 1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142118664 Original CRISPR CTGTGCACACAGCTGGGGCA GGG Intergenic
No off target data available for this crispr