ID: 1142122968

View in Genome Browser
Species Human (GRCh38)
Location 16:88396403-88396425
Sequence CCTTCAGGAGGGTCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142122968_1142122978 4 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122978 16:88396430-88396452 CTGGGAGGAGACCCTTATGAAGG No data
1142122968_1142122979 5 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122979 16:88396431-88396453 TGGGAGGAGACCCTTATGAAGGG No data
1142122968_1142122982 13 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122982 16:88396439-88396461 GACCCTTATGAAGGGAGGCCGGG No data
1142122968_1142122980 8 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122980 16:88396434-88396456 GAGGAGACCCTTATGAAGGGAGG No data
1142122968_1142122981 12 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122981 16:88396438-88396460 AGACCCTTATGAAGGGAGGCCGG No data
1142122968_1142122985 16 Left 1142122968 16:88396403-88396425 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142122985 16:88396442-88396464 CCTTATGAAGGGAGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142122968 Original CRISPR CCTTCAGGAGGGTCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr