ID: 1142123013

View in Genome Browser
Species Human (GRCh38)
Location 16:88396538-88396560
Sequence CCTTCAGGAGGGTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123013_1142123023 5 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123023 16:88396566-88396588 CAGATGGAGACCCTCCTGAAGGG No data
1142123013_1142123026 13 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123026 16:88396574-88396596 GACCCTCCTGAAGGGAGGCCGGG No data
1142123013_1142123024 8 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123024 16:88396569-88396591 ATGGAGACCCTCCTGAAGGGAGG No data
1142123013_1142123029 16 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG No data
1142123013_1142123022 4 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data
1142123013_1142123025 12 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123025 16:88396573-88396595 AGACCCTCCTGAAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123013 Original CRISPR CCTTCAGGAGGGTCTCCTCC CGG (reversed) Intergenic