ID: 1142123022

View in Genome Browser
Species Human (GRCh38)
Location 16:88396565-88396587
Sequence CCAGATGGAGACCCTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123010_1142123022 20 Left 1142123010 16:88396522-88396544 CCCGTCTGAAGGGAGGCCGGGAG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data
1142123017_1142123022 -7 Left 1142123017 16:88396549-88396571 CCCTCCTGAAGGGAGGCCAGATG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data
1142123013_1142123022 4 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data
1142123018_1142123022 -8 Left 1142123018 16:88396550-88396572 CCTCCTGAAGGGAGGCCAGATGG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data
1142123011_1142123022 19 Left 1142123011 16:88396523-88396545 CCGTCTGAAGGGAGGCCGGGAGG No data
Right 1142123022 16:88396565-88396587 CCAGATGGAGACCCTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123022 Original CRISPR CCAGATGGAGACCCTCCTGA AGG Intergenic