ID: 1142123029

View in Genome Browser
Species Human (GRCh38)
Location 16:88396577-88396599
Sequence CCTCCTGAAGGGAGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123017_1142123029 5 Left 1142123017 16:88396549-88396571 CCCTCCTGAAGGGAGGCCAGATG No data
Right 1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG No data
1142123020_1142123029 1 Left 1142123020 16:88396553-88396575 CCTGAAGGGAGGCCAGATGGAGA No data
Right 1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG No data
1142123018_1142123029 4 Left 1142123018 16:88396550-88396572 CCTCCTGAAGGGAGGCCAGATGG No data
Right 1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG No data
1142123013_1142123029 16 Left 1142123013 16:88396538-88396560 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123029 Original CRISPR CCTCCTGAAGGGAGGCCGGG CGG Intergenic